Introduction
Endometrial carcinoma (EC) is the sixth most prevalent cancer in women, with over 400,000 new diagnoses made in 2020, according to global cancer statistics (Sung et al.
2021). Though many early-stage EC cases are cured with surgery alone, there are a notable number of women with aggressive variants whose prognosis remains dismal (Crosbie et al.
2022; Oaknin et al.
2022a). Traditionally, EC was subclassified into two types based on its clinical and pathological features. Type I ECs are more common and result from unopposed estrogenic stimulation of the endometrium (Bokhman
1983). The histotypes of type I ECs are mostly endometrioid with indolent biological behavior, accompanied by PTEN and KRAS mutations and microsatellite instability (MSI) status aberrance (Huvila et al.
2021). In contrast, type II ECs are aggressive phenotypes and are high-grade carcinomas. This subtype is primarily identified by p53 mutations and is considered the cause of relapse and death. (Brinton et al.
2013).
In 2013, The Cancer Genome Atlas (TCGA) Research Network proposed molecular subtypes of EC based on genomic profiles. These subtypes are the POLEmut group, MMRd (hypermutated/microsatellite unstable) group, SMP (no specific molecular profile) group, and p53abn (serous-like) group (Kandoth et al.
2013). Other than significant molecular abnormalities, these molecular subtypes differ in terms of genetic and environmental risk factors, prognosis, and response to hormonal therapy (Huvila et al.
2021). Surrogate markers for these molecular subtypes have been developed and successfully implemented in clinical practice (Talhouk et al.
2015,
2017; Stelloo et al.
2016). However, challenges remain in current EC classification systems, particularly in prognostic and therapeutic evaluation (McAlpine et al.
2018). Thus, new molecular patterns defining prognosis and therapeutic response in EC are urgently needed.
The G protein-coupled receptors (GPRs) family, a large superfamily of cell-surface signaling proteins, is involved in a variety of biological processes, including cell adhesion and motion (Orduna-Castillo et al.
2022), metabolites signaling transduction (Uranbileg et al.
2022; Brown et al.
2020; Pillai et al.
2022), and even immune responses (Ge et al.
2020). Aberrant GPR expression has been observed in various cancers (Bar-Shavit et al.
2016). Recent GPRs function research has highlighted mechanisms related to metabolites among these carcinous patterns. As a metabolic response to acid stress, the acid-sensing GPR (GPR68) has been reported to mediate lipogenesis in cancer cells, thereby promoting lipid droplet accumulation and enhancing viability under acidic stress (Pillai et al.
2022). In human hepatocellular carcinoma (HCC), S1P lyase (SPL) converts sphingolipids into glycerophospholipids (LPI and LPG). These subsequently combine with GPR55 and activate the p38/MAPK pathway, contributing to tumor progression (Uranbileg et al.
2022). Other metabolite-related GPRs, including lactate receptor (GPR81) (Brown et al.
2020), succinate receptor‑1 (GPR91) (Kuo et al.
2022), neurokinin-1 receptor (Zhang et al.
2022), and purinergic receptor (Wang et al.
2020), were extensively investigated in cancer research. In ECs, estrogenic transmembrane receptor (GPR30) has been extensively studied over the decade (He et al.
2009). Numerous evidence has already revealed that estrogen-mediated GPR signaling played a critical role in gaining malignant phenotypes (He et al.
2012; Zhang et al.
2019). In light of the preceding, it is necessary to propose a novel GPR molecular set that can shed light on EC prognosis and biological behavior.
Interestingly, numerous GPRs have been studied for their immunological functions. Activation of A2A receptors (A2AR), a typical GPR with a high affinity for adenosine, has been shown to promote the immune escape of cancer cells in tumor niche (Sun et al.
2022). The lactate receptor (GPR81) in breast cancer nidus promotes tumor growth through a paracrine mechanism involving dendritic cell (DCs) function impairment. This paracrine mechanism is complementary to an autocrine mechanism by which lactate induces programmed cell death ligand 1 (PD-L1) in tumor cells via activation of GPR81; therefore, inhibition of GPR81 signaling may provide a novel cancer immunotherapy strategy (Brown et al.
2020). Activated by low pH, proton-sensing GPR has been reported to promote PD-L1 expression in tumor cells (Mori et al.
2021). GPR87 expression is positively correlated with immune infiltration in lung adenocarcinoma (LUAD), suggesting potential benefits from immune checkpoint inhibitors (ICIs) (Bai et al.
2022). Another GPR, lysophosphatidic acid receptor 6 (LPAR6), was excluded from the immune infiltration evaluation (He et al.
2022,
2021). Therefore, given that ICIs agents are widely investigated for treating ECs (Ott et al.
2017; Makker et al.
2019), a series of biomarkers linking GPRs and immune features are ready for clinical application.
Materials and methods
Data sources and available analysis platforms
A compendium of 872 GPR-related genes was acquired from the Molecular Signatures Database (MSigDB;
http://www.gsea-msigdb.org/gsea/msigdb) (Liberzon et al.
2015). Expression of all GPR-related genes was extracted from the Cancer Genome Atlas-Uterine Corpus Endometrioid Carcinoma (TCGA-UCEC) cohort. The CIBERSORT algorithm (
https://cibersort.stanford.edu/) (Chen et al.
2018) was applied to quantify 22 immune cells based on the transcriptomes of the TCGA-UCEC cohort for tumor immune microenvironment (TME-i) cells.
Establishment of GPR score, TME score, and GPR-TME classifier
DEGs of GPR between ECs and normal uterine tissue were first extracted for subsequent analysis (“limma” package, version 3.50.3; Log (FC) > 1 or < − 1, P < 0.05 were regard as the cutoff). The prognostic assessment of GPR-related genes and TME-i cells was further narrowed by univariate Cox regression analysis in the TCGA-UCEC cohort (“survminer” R package; version 0.4.9; with a cutoff of P < 0.05). Five protective immune cells were isolated for TME score construction, and 20 GPR-related genes were identified using the Least Absolute Shrinkage and Selection Operator (LASSO) regression model to generate a GPR risk signature (GPR score). An advanced algorithm, “bootstrap,” was applied to stabilize the coefficient generated from LASSO in both the GPR and TME score constructions. Simply, the GPR score was assigned by.
\(\mathrm{GPR score}={\sum }_{i=1}^{20}Xi\times Yi\).
Likewise, the TME score was given by.
\(\mathrm{TME score}={\sum }_{j=1}^{5}Xj\times Yj\).where \(Xi\) is the relative expression value of each selected gene, \(Yi\) is the coefficient modified by the “bootstrap” algorithm; \(Xj\) is the relative expression value of each selected immune cell, and \(Yj\) is the coefficient modified the same algorithm. The GPR and TME scores were then integrated to develop the GPR-TME classifier. Subsequently, EC samples were divided into the following subgroups: GPR_high + TME_low, intermediate mixed (GPR_high + TME_low and GPR_low + TME_low), and GPR_low + TME_high based on the mean value of GPR score and TME score in TCGA-UCEC cohort.
Single-sample gene set enrichment analysis and fast gene set enrichment analysis
The “clusterProfiler” package (version 4.4.4) was used for single-sample gene set enrichment analysis (ssGSEA) to clarify the pathways enriched in different subgroups based on the expression level of GPR or TME-i cells (Liu et al.
2020). After combining the intermediate subgroups, the “fgsea” (version 1.20.0) and the “msigdbr” (version 7.5.1) packages were applied for fast GSEA analysis.
Comprehensive analysis of GPR score in a scRNA sequencing set
A unique sample of scRNA sequencing data (MSI‑H/MMR‑d EC) containing only immune cells was enrolled for GPR expression analysis among these infiltrative cells. The “Seurat” (version 4.3.0), “tidyverse” (version 1.3.2), and other subordinate packages were used to visualize the abundance of GPR scores in TME-i cells. Furthermore, the “CellChat” package (version 1.6.1) was used to outline intercellular communication.
Weighted correlation network analysis based on GPR-TME classifier
Weighted correlation network analysis (WGCNA) can be used to identify clusters of highly correlated genes and summarize them using the module eigengene or an intramodular hub gene (Langfelder and Horvath
2008). Thus, the “WGCNA” R package (version 1.71) was used to generate distinct modules (sft value was set as 0.90; Supplementary Fig. 1A). Then the desired module (marked “yellow”) was identified, and the gene clusters belonging to this module were submitted to Metascape for functional analysis.
Tumor somatic mutation, functional annotation, and TIP analysis
Somatic mutation data was available in the TCGA- UCEC database. The top 20 mutation genes were obtained using the “maftools” package (4.1.2) and then compared between GPR-TME subgroups. Hub genes with significant differences among GPR-TME subgroups were then extracted and analyzed. As described previously (Liu et al.
2022), each EC case's tumor mutation burden (TMB) score was also calculated. DEGs analysis was repeated before submitting to Proteomaps for functional annotation. Ten cases of each GPR-TME subgroup (including the mix subgroup) were randomly sampled to generate a matrix before TIP analysis. The returned online tool data were then visualized using the “pheatmap” R package (version 1.0.12).
Quantitative real time PCR
Tissue RNA Purification Kit PLUS (EZBiosciences, China) was utilized to extract RNA from EC tissue samples (twelve pairs). After extraction, NanoDrop 2000 spectrophotometer (Thermo Scientific, USA) was used to detect RNA quantity and concentration. Hifair
® III Reverse Transcriptase Kit (YEASEN, China) was subsequently designed for reverse transcription of total RNA to cDNA. Quantitative real time PCR (qRT-PCR) was conducted using the Taq Pro Universal SYBR qPCR Master Mix Kit (Vazyme, China). Record the cycling threshold (Ct) for P2RY14 and calculate the P2RY14 mRNA expression in cancer and paracancerous tissues with the 2
−ΔΔCt method. All steps of the qRT-PCR were performed according to the reagent instructions and all experiments were repeated three times. The primers used in qRT-PCR protocol are presented in Table
1.
Table 1
The primers used in qRT-PCR
P2RY14 | AGCTGAACGTGTTTGTGTGC | GGAACAGCAAGGAGGAGCAT |
GAPDH | GACTTCAACAGCAACTCCCAC | TCCACCACCCTGTTGCTGTA |
Statistical analysis
All statistical analysis was performed in R (version 4.1.0). Standard tests included the Student’s t test, Wilcoxon rank-sum test, and Kruskal–Wallis test. Spearman correlation analysis (“ggcorrplot” R package; version 0.1.4) was used to determine the relationship between the GPR-related genes/TME-i cells. The log-rank test and Cox regression were used to investigate related independent patients’ prognosis classifiers. P < 0.05 was considered statistically significant.
Discussion
The explosion of research on GPR and TME enhances our understanding of the possibility of combining these factors to predict cancer patients' prognosis and therapies (O’Hayre et al.
2014). However, few studies have integrated GPR and TME signatures to predict prognosis and therapeutic responses (Zhao et al.
2022). Signatures based on the combination of GPR and TME may enable clinical classification and therapeutic strategy optimization when targeting GPR combined with immunotherapy for EC treatment. Here, we systematically utilized the TCGA-UCEC cohort to assess the prognostic and therapeutic value of the GPR-TME classifier.
In this study, twenty GPR-related genes were enrolled in our risk signature, including adrenoceptor, prostaglandin receptors, vasoactive intestinal peptide (VIP) receptors, dopamine receptors, lysophosphatidic acid receptors, corticotropin-releasing hormone (CRH) receptors, purinergic receptors, bradykinin receptors, among others. Many of these novel targets have been studied in EC research. Dopamine receptor D2 (DRD2) overexpression in EC was significantly associated with grade, serous histology, stage, and worse progression-free survival and overall survival. While antagonizing DRD2 with ONC201 exhibited significant anti-tumorigenic effects in EC cells and an EC transgenic mouse model (Pierce et al.
2021). DRD2 was reported to promote malignant tumor progression by activating the oxygen-independent hypoxia-inducible factor-1α (HIF-1α) pathway in response to psychologic stress (Liu et al.
2021b). Similarly, CRHR1 was identified as an independent prognostic factor for EC in disease-free survival (DFS) and OS (Sato et al.
2014). A subfamily of adhesion GPRs in EC was recently thoroughly analyzed, and ADGRF1 was highlighted for its dual role in prognosis prediction and immune infiltrating evaluation (Lei et al.
2022). Purinergic receptors, the most common GPRs in the current model, play critical roles in various cancers. Purinergic receptor P2Y2 (P2RY2) activation has been reported to promote tumor cell proliferation via multiple downstream signaling pathways (Zaparte et al.
2021; Dong et al.
2022). The P2RY2 enhancer RNA (P2RY2e) has been validated as an estrogen-responsive eRNA and has been involved in the development of breast cancer and the progression of bladder cancer (Ding et al.
2018). Given that EC is an estrogen-related malignancy, we suggested that enhanced expression of P2RY2 induced by unopposed estrogenic stimulation may also promote the progression of EC. Conversely, down-regulation of P2RY14 in head and neck squamous cell carcinoma (HNSC) patients was associated with poor prognosis and reduced immune infiltration, indicating a conversion from immune-dominant to metabolic-dominant status (Li et al.
2021). The down-regulation of P2RY14 in TME of EC needs further investigation, as confirmed by the GEO dataset and clinical tissue samples (Fig.
9). Many GPRs in the galectin (GAL) subfamily were associated with immune suppression and regulated cytotoxicity T cell fate (Cagnoni et al.
2021; Yang et al.
2021), highlighting potential therapeutic targets for cancer immunotherapy. GPR132 mediates tumor-macrophage interactions to promote the alternatively activated M2-like phenotype by detecting lactate in the acidic tumor microenvironment. This facilitates cancer cell adhesion, migration, and invasion (Chen et al.
2017). Overall, research focusing on GPR functions and their interaction with tumor immune microenvironment has the potential to broaden the horizons of cancer immunology.
For the other part of the classifier, the TME score also exerts its critical role in cancer control. This model identified CD8 T cells, memory-activated CD4 T cells, activated NK cells, Tfh cells, and plasma cells as EC TME protectors. The anti-cancer effect of CD8 T cells, activated CD4 T cells, and activated NK cells have been verified in multiple cancers. Since in-depth research has been conducted on antitumor immunity, the function of Tfh cells and plasma cells in TME has emerged gradually. Tfh cells not only function in shaping B cell response during germinal center formation (Hollern et al.
2019) but also exert an antitumor immune effect in a CD8
+-dependent manner. Tfh cells restore the exhausted T cells’ cytotoxic functions by producing interleukin-21 (IL-21), thereby enhancing the anti-PD-L1/PD-1 efficacy (Niogret et al.
2021). Plasma cells secrete specific antibodies into tumor niche as executors of humoral immunity. A recent study in EC has demonstrated that polymeric immunoglobulin receptor (pIgR) dependent, antigen-independent IgA occupancy triggers the activation of interferon (IFN) and tumor necrosis factor (TNF) signaling pathway in tumor cells. This activation is accompanied by apoptotic and endoplasmic reticulum stress downstream while hindering the DNA repair mechanisms (Mandal et al.
2022). After reannotating the EC scRNA sequencing dataset with MSI‑H/MMR‑d (Guo et al.
2022), the GPR score was significantly elevated in pDC and NKT cells. The intercellular communication analysis revealed impaired cell-chatting function in these GPR-elevated cells. Jiang et al. recently depicted that single-cell profiling of the immune atlas of tumor-infiltrating lymphocytes (TILs) in EC (Jiang et al.
2022). There was a cluster of NKT cells in their TILs atlas; however, the specific functions of this cluster have not been thoroughly analyzed yet.
Throughout the study, EC patients in the GPR_low + TME_high subgroup exhibited the most favorable prognosis and clinical responses to ICB treatment. The time-dependent ROC curves confirmed the sensibility and specificity of this risk signature. When merged for simplification, the GPR-TME classifier was identified as an independent prognostic factor for EC patients. This classifier’s OS predictive value was independent of the patient’s age, tumor grade, and stage, indicating a stable prediction efficiency. Moreover, multiple algorithms methods for functional annotation revealed different biological process enrichment among GPR-TME subgroups. This may imply that the host tumor profiles of the various GPR-TME subgroups share certain common characteristics. The results of tumor somatic mutations analysis revealed subtle correlations between the molecular subtyping of EC and the GPR-TME subgroup. The frequent TP53 mutations observed in the GPR_high + TME_low subgroup suggest a large body of copy number high (CN-H) molecular subtyping in this cluster. This corresponds to higher cell proliferation potentials and poor prognosis (Kandoth et al.
2013; Talhouk et al.
2015). Conversely, the GPR_low + TME_high subgroup indicated more common PTEN and ARID1A mutations suggesting potential association with other molecular subtypes (Kandoth et al.
2013; Stelloo et al.
2016). Further studies are needed to elucidate this vague relationship.
Immunotherapy has presented clinical efficacy in some patients with gynecological malignancies (Taha et al.
2020), primarily employed for advanced and recurrent cases that have failed conventional treatment. Among the three major gynecological malignancies, EC is the most curable. Currently, the evidence of ICIs application in advanced/recurrent EC mainly comes from the KEYNOTE series clinical trials of Pembrolizumab (KEYNOTE-016, KEYNOTE-158, KEYNOTE-028) (Ott et al.
2017; Le et al.
2015; O'Malley et al.
2022). The objective response rate (ORR) for Pembrolizumab in EC patients with MSI-H/dMMR ranged from 53.0% to 57.1% in the KEYNOTE trials. Similarly, the ORR for Nivolumab and Dostarlimab-gxly in EC patients with dMMR was over 40% in the EAY131 (Azad et al.
2020) and GARNET (Oaknin et al.
2022b) studies. These studies provide additional support using PD-1/PD-L1 mAbs in previously treated patients with MSI-H/dMMR advanced/recurrent EC. Notably, MSI-H/dMMR patients are the primary recipients of ICIs. However, only approximately 25% of EC patients have MSI-H/dMMR aberrance (Stelloo et al.
2016). This indicates that it is unclear whether immunotherapy will benefit the remaining patients. In our GPR-TME classifier, over 30% of patients in the GPR_low + TME_high subgroup were successfully predicted to benefit from immunotherapy regardless of the molecular subtyping. In contrast, merely 3% of GPR_high + TME_low patients were predicted to respond to ICB treatment, which is discouraged for immunotherapy.
Finally, we acknowledge certain limitations to this study. Firstly, the lack of survival data for EC necessitates the inclusion of more cohorts, particularly the in-house cohort, to further assess the performance of this classifier. Secondly, the GPR-TME signatures require additional validation using experimental methods.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.