Introduction
Materials and methods
Patients and samples
Characterization of Enterococcus species
Name of primer | Target gene | Sequence (5’→3’) | Size of product (bp) | Source |
---|---|---|---|---|
EA1 (F) | vanA | GGGAAAACGACAATTGC | 732 | [31] |
EA2 (R) | vanA | GTACAATGCGGCCGTTA | ||
EB3 (F) | vanB | ACGGAATGGGAAGCCGA | 647 | [32] |
EB4 (R) | vanB | TGCACCCGATTTCGTTC | 647 | |
EC5 (F) | vanC1/2 | ATGGATTGGTAYTKGTAT | 815/827 | [32] |
EC8 (R) | vanC1/2 | TAGCGGGAGTGMCYMGTAA | 815/827 | |
ED1 (F) | vanD | TGTGGGATGCGATATTCAA | 500 | [32] |
ED2 (R) | vanD | TGCAGCCAAGTATCCGGTAA | 500 | |
DD13 (F) | ddl (E. faecalis) | CACCTGAAGAAACAGGC | 475 | [32] |
DD3-2 (R) | ddl (E. faecalis) | ATGGCTACTTCAATTTCACG | 475 | |
FAC1-1 (F) | ddl (E. faecium) | GAGTAAATCACTGAACGA | 1091 | [32] |
FAC2-1 (R) | ddl (E. faecalis) | CGCTGATGGTATCGATTCAT | 1091 | |
RAPD 1247 | RAPD sequence | AAGAGCCCGT | [33] | |
RAPD 1283 | RAPD sequence | GCGATCCCCA | [34] |
Antimicrobial susceptibility testing
Molecular detection of vanA, vanB, vanC, vanD genes
RAPD typing and homology analysis
Data analysis
Results
Patients’ demographics
Variables | Frequency |
---|---|
Gender | |
Female | 34.9% (15/43) |
Male | 65.1% (28/43) |
Age | |
<1 year | 58.1% (25/43) |
1–3 years | 16.3% (7/43) |
4–6 years 7–10 years >10 years | 7% (3/43) 14% (6/43) 4.7% (2/43) |
LOS | |
≤3 days | 39.5% (17/43) |
4–7 days | 34.9% (15/43) |
≥8 days | 25.6% (11/43) |
Underlying diseases | |
Underlying disease | 60.5% (26/43) |
Non-underlying disease | 39.5% (17/43) |
History of hospitalization | |
Yes | 55.8% (24/43) |
No | 39.5% (17/43) |
Antibiotic therapy | |
Cephalosporin | 72.1% (31/43) |
Carbapenem | 30.2% (13/43) |
Glycopeptide | 41.9% (18/43) |
Aminoglycoside | 9.3% (4/43) |
Fluoroquinolone | 4.7% (2/43) |
Nitroimidazole | 27.9% (12/43) |
Macrolide | 11.6% (5/43) |
Lincosamide | 7% (3/43) |
Penicillin | 2.3% (1/43) |
Ansamycin | 2.3% (1/43) |
β-lactam combination agents | 2.3% (1/43) |
Species diversity of Enterococci in the stool of children at the admission and discharge times
Antibiotic Resistance Among the fecal Enterococci | Admissiona. % (n = 43) | Dischargea. % (n = 43) | p-value | Days of hospitalization (Mean ± SD) | p-value | Antibiotic prescription in hospital | p-value | ||
---|---|---|---|---|---|---|---|---|---|
≤ 3 | 4–7 | ≥ 8 | |||||||
Vancomycin (30 µg) | 32.6% (14/43) | 41.9% (18/43) | 0.50 | 22.2% (4) | 33.3% (6) | 44.4% (8) | 0.04 | Cephalosporin | 0.01 |
Glycopeptide | 0.01 | ||||||||
Aminoglycoside | 0.02 | ||||||||
Nitroimidazole | 0.04 | ||||||||
E. faecalis | 20.7% (6) | 22.2% (6) | 1 | 33.3% (2) | 33.3% (2) | 33.3% (2) | 0.37 | -b | - |
E. faecium | 50% (4) | 78.6% (11) | 0.3 | 18.2% (2) | 36.4% (4) | 45.5% (5) | 1 | - | - |
Gentamicin (120 µg) | 25.6% (11/43) | 27.9% (12/43) | 1 | 41.7% (5) | 16.7% (2) | 41.7% (5) | 0.20 | Aminoglycoside | 0.07 |
Macrolide | 0.02 | ||||||||
E. faecalis | 24.1% (7) | 29.6% (8) | 0.75 | 50% (4) | 25% (2) | 25% (2) | 0.72 | - | - |
E. faecium | 12.5% (1) | 21.4% (3) | 1 | 33.3% (1) | 0% (0) | 66.7% (2) | 0.38 | - | - |
Ampicillin (10 µg) | 41.9% (18/43) | 48.8% (21/43) | 0.66 | 23.8% (5) | 33.3% (7) | 42.9% (9) | 0.02 | Cephalosporin | 0.04 |
Glycopeptide | 0.06 | ||||||||
Aminoglycoside | 0.04 | ||||||||
E. faecalis | 27.6% (8) | 25.9% (7) | 1 | 28.6% (2) | 42.9% (3) | 28.6% (2) | 0.31 | - | - |
E. faecium | 75% (6) | 85.7% (12) | 0.60 | 16.7% (2) | 33.3% (4) | 50% (6) | 0.47 | - | - |
Chloramphenicol (30 µg) | 4.7% (2/43) | 9.3% (4/43) | 0.67 | 25% (1) | 50% (2) | 25% (1) | 0.81 | - | - |
E. faecalis | 6.9% (2) | 11.1% (3) | 0.66 | 33.3% (1) | 33.3% (1) | 33.3% (1) | 0.53 | - | - |
E. faecium | 0% (0) | 7.1% (1) | 1 | 0% (0) | 100% (1) | 0% (0) | 0.58 | - | - |
Tetracycline (30 µg) | 74.4% (32/43) | 67.4% (29/43) | 0.60 | 48.3% (14) | 27.6% (8) | 24.1% (7) | 0.26 | - | - |
E. faecalis | 75.9% (22) | 66.7% (18 ) | 1 | 66.7% (12) | 22.2% (4) | 11.1% (2) | 0 | - | - |
E. faecium | 75% (6) | 64.3% (9) | 0.61 | 11.1% (1) | 44.4% (4) | 44.4% (4) | 0.17 | - | - |
Nitrofurantoin (300 µg) | 4.7% (2/43) | 0% (0/43) | 0.49 | 0% (0) | 0% (0) | 0% (0) | 1 | - | - |
E. faecalis | 3.4% (1) | 0 (0%) | 1 | 0% (0) | 0% (0) | 0% (0) | 1 | - | - |
E. faecium | 12.5% (1) | 0 (0%) | 0.38 | 0% (0) | 0% (0) | 0% (0) | 1 | - | - |
Erythromycin (15 µg) | 72.1% (31/43) | 74.4% (32/43) | 0.76 | 31.3% (10) | 37.5% (12) | 31.3% (10) | 0.74 | - | - |
E. faecalis | 65.5% (19) | 63% (17) | 1 | 41.2% (7) | 41.2% (7) | 17.6% (3) | 1 | - | - |
E. faecium | 87.5% (7) | 92.9% (13) | 1 | 15.4% (2) | 38.5% (5) | 46.2% (6) | 1 | - | - |
Ciprofloxacin (5 µg) | 41.9% (18/43) | 58.1% (25/43) | 0.25 | 28% (7) | 32% (8) | 40% (10) | 0.05 | - | - |
E. faecalis | 27.6% (8) | 40.7% (11) | 0.38 | 36.4% (4) | 36.4% (4) | 27.3% (3) | 0.48 | - | - |
E. faecium | 75% (6) | 85.7% (12) | 1 | 16.7% (2) | 33.3% (4) | 50% (6) | 0.47 | - | - |
Rifampicin (5 µg) | 46.5% (20/43) | 58.1% (25/43) | 0.35 | 32% (8) | 32% (8) | 36% (9) | 0.37 | - | - |
E. faecalis | 31% (9) | 37% (10) | 0.76 | 40% (4) | 40% (4) | 20% (2) | 0.86 | - | - |
E. faecium | 87.5% (7) | 92.9% (13) | 1 | 23.1% (3) | 30.8% (4) | 46.2% (6) | 0.57 | - | - |
MDR | 48.8% (21/43) | 65.1% (28/43) | 0.19 | 32.1% (9) | 35.7% (10) | 32.1% (9) | 0.31 | - | - |
E. faecalis | 37.9% (11) | 51.9% (14) | 0.42 | 42.9% (6) | 35.7% (5) | 21.4% (3) | 0.76 | - | - |
E. faecium | 87.5% (7) | 85.7% (12) | 1 | 16.7% (2) | 41.7% (5) | 41.7% (5) | 0.67 | - | - |
Common Resistance phenotypes | Van/Amp/Tet/Cip/Rif/E/G 9.3% (4) | Van/Amp/Tet/Cip/Rif/E 14% (6) | - | - | - | - | - | ||
Van/Amp/Tet/Cip/Rif/E 7% (3) | Van/Amp/Tet/Cip/Rif/E/G 9.3% (4) | ||||||||
Amp/Tet/Cip/Rif/E 4.7% (2) | Van/Amp/Cip/Rif/E/G 7% (3) | ||||||||
Van/Amp/Cip/Rif/E 7% (3) | |||||||||
Amp/Tet/Cip/Rif/E 7% (3) | |||||||||
Tet/E/G 4.7% (2) | |||||||||
Tet/Cip/Chl/E 4.7% (2) |
Frequency of fecal enterococci with VR and HLGR phenotypes among the children
Bacterial species | Primary stool a N= (n, %) | Secondary stool b N= (n, %) |
---|---|---|
E. feacalis | 67.4% (29/43) | 62.8% (27/43) |
E. faecium | 18.6% (8/43) | 32.6% (14/43) |
Other- Enterococcus spp. | 14% (6/43) | 4.7% (2/43) |
E. faecalis-VRE | 42.9% (6/14) | 33.3% (6/18) |
E. faecium VRE | 28.6% (4/14) | 61.1% (11/18) |
E. faecalis HLGR | 63.6% (7/11) | 66.7% (8/12) |
E. facium HLGR | 9.1% (1/11) | 25% (3/12) |
E. faecalis MDR | 52.4% (11/21) | 50% (14/28) |
E. faecium MDR | 33.3% (7/21) | 42.9% (12/28) |