Systemic inflammation and chronic kidney disease in a patient due to the RNASEH2B defect

Genomic DNA was extracted from peripheral blood cells isolated from the patient and her parent. The exonic regions and flanking splicing or intronic junctions of the whole genome were captured and sequenced using an Illumina HiSeq 2000 sequencer conducted by MyGenostics (Beijing, China). The FASTQ files were mapped to the human reference genome (hg19). The functional effects of variants were predicted using three algorithms (PolyPhen-2, SIFT, and MutationTaster), and amino acid conservation among species was analyzed. Sanger sequencing was used to confirm pathogenic variants. The primers used to target human RNASEH2B included (forward: CAGGGATTTGAAGCTCTTTGG) and (reverse: TAGTGCTCTGTCCTGCACTGG).

Peripheral blood mononuclear cells (PBMCs) were isolated by Ficoll-Paque PLUS (GE Healthcare) gradient density centrifugation and ACK lysis (Quality Biological). PBMCs were resuspended in complete RPMI (cRPMI) medium (Gibco, USA) containing 10% fetal bovine serum (BI, Israel), 2 mM glutamine, and penicillin-streptomycin (100 U/mL each; Sigma-Aldrich, USA). Cells at 1 × 10⁶/mL were exposed to cyclic guanosine monophosphate-adenosine monophosphate (cGAMP, CST#35573) at the concentration of 10 μg/ml.

After exposure to cGAMP in vitro for 24 h, mRNA expression of 12 IFN-stimulated cytokine genes in PBMCs was assessed. Total RNA was extracted from PBMCs isolated from the patient and five HCs by RNA isolation kit (DP424, TIANGEN). cDNA was derived following the GoScript Reverse Transcription System kit(A5001, Promega). Quantitative reverse transcription PCR analysis was performed with the GoTaq qPCR Master Mix (A6002, Promega). Primers for PCR included were described in the supplementary material.

Plasma samples were isolated from the patient and 15 HCs. Cerebrospinal fluid (CSF) sample was collected from the patient. Blood samples were collected in vacutainers containing sodium heparin. Plasma cytokine analyses were determined on a bead-based immunoassay (Milliplex, HCYTOMAG-60 K, Millipore, USA) according to the manufacturer’s protocol.

Data were analyzed using an unpaired two-tailed Student t-test. All statistical analyses were conducted in GraphPad Prism 7 software (GraphPad Software, Inc., San Diego, CA).

The patient presented with recurrent fever, arthritis, movement limitation, and growth retardation at the age of 11 years. At the age of 2 years, she began to suffer from recurrent aseptic fever with an intermittent resolution by traditional Chinese medicine. At the age of 5 years, she began to present with arthritis accompanied by mild hearing loss. She was born to a non-consanguineous healthy parent. At birth, her weight was 3 Kg, crown to heel length was 49 cm, and head circumference was 34 cm. She had standard motor and language development. Manifestations of failure to thrive had been significant since she was 3 years old. Physical examination revealed short stature with 106 cm top(<−3SD)(Fig. 1B3), macrocephaly with 54 cm head width, chilblains on elbows and lower limbs (Fig. 1B2), swelling and deformation of inter-phalangeal and knee joints (Fig. 1B1). Her Intelligence Quotient (IQ) test value was 108. Her EPQJ, CBCL, Conners, and HAMA scale tests did not demonstrate any social and psychological problems. Knee magnetic resonance imaging (MRI) revealed a thickness of the synovial capsule without invasive bone destruction (Fig. 1B4). Cerebral MRI showed cerebral atrophy and white matter abnormalities (Fig. 1B6). Intracranial calcification was further identified at the basal ganglia and cerebellum by CT scanning (Fig. 1B5 and Fig. 1B7). Laboratory findings revealed hyper-inflammation and chronic kidney disease (Fig. 1c, Fig. 2b, and Fig. 2f). Screening tests for fungal, bacteria, and Mycobacterium tuberculosis infection were all negative. Pathology of the renal biopsy showed glomerular sclerosis in 3 of 14 glomeruli, a mild proliferation of mesangial cells without deposits of any amyloid, immunoglobulin or immune complex, expansion of the tubular lumen, partial tubular atrophy, mild tubular fibrosis, infiltration of lymphocytes and other mononuclear cells (Fig. 1c). Granule degeneration and calcium deposition were visible in renal tubules. Austin score index for the evaluation of activity and chronicity was two and three points, respectively.

Analysis of peripheral blood leukocyte revealed persistent lymphopenia (Fig. 2a). Except for rheumatoid factor (RF) and anti-cyclic peptide containing citrulline (anti-CCP), other auto-antibodies for mixed connective tissue disease were all negative, including anti-nuclear antibody (ANA), anti-neutrophil cytoplasmic antibody (ANCA), anti-SSA, anti-SSB, anti-dsDNA, anti-thyroglobulin, anti-thyroperoxidase, and anti-TSH receptor antibodies. Other abnormal clinical and immunologic phenotypes included intermediate elevation of IgM and IgA levels (Fig. 2c) and mild reduction of C3 and C4 levels (Fig. 2d).

Whole exon sequencing revealed three variants in the RNASEH2B gene (OMIM:610181). There was a single nucleotide homozygous variant, c.859G > T, p.A287S (Fig. 1a). Predicted values of SIFT, PolyPhen_2, Mutation Taster, and GERP++ were 0.235, 0.721, 1, and 6.06, suggesting tolerated, possibly damaging, and disease-causing effects, respectively. Both parents carried a heterozygous mutation at the same locus. Another single-nucleotide heterozygous variant, c.269C > T, p.P90L, was identified (Fig. 1a). The predicted values of SIFT, PolyPhen_2, Mutation Taster, and GERP++ were 0.002, 0.988,1, and 4.69, suggesting damaging, probably damaging, and disease-causing effects, respectively. This heterozygous variation was further confirmed by Sanger in both her parents. Both variations were in the conserved domains. Pathogenic variants were not identified in other genes related to autoinflammation, autoimmunity, or inherited renal disorders (Supplemental Table).

After exposure to cGAMP in vitro for 24 h, mRNA expression of IFN-stimulated cytokine genes in PBMCs was detected by real-time PCR. In contrast to five healthy controls, over-expression of IFN-stimulated cytokine genes was observed in the patient, including IFI44, IFI27, IFIT1, IFIT2, IFIT3, ISG15, OAS1, and SIGLEC1. Normal mRNA expressions were found in IFNβ1 and IRF9 (Fig. 3b).

Compared to 15 age-matched healthy controls, plasma cytokine levels were significantly elevated, including interleukin (IL)- 1β, IL-6, tumor necrosis factor-α (TNFα), interferon-γ (IFN-γ), IFN-α, IL-4, IL-10, IL-12, IL-17A and IP-10 (Fig. 3a and Table 1). IFN-α level in CSF was very low.

A one-year course of growth hormone showed no response to improve her short stature. She had received long-term treatment of ibuprofen, methotrexate, folic acid, and prednisone for more than 5 years. Aseptic fever relapsed intermittently. Tocilizumab was started for the high dose dependence of glucocorticoids and elevated pro-inflammatory cytokine levels. Following a 48-week course of tocilizumab, the prednisone dose was gradually reduced to 0.2῀0.3 mg/Kg.d with partial improvement of some abnormal laboratory findings (Fig. 2b and Fig. 2f). However, urine β2 microglobulin level was persistently elevated markedly (Fig. 2e). Tocilizumab was discontinued. She began to receive tofacitinib (5 mg, twice every day) for the over-expression of IFN-stimulated cytokine genes. The 48-week course of tofacitinib led to partial response, including increased lymphocytes, C3 and C4 levels, reduced levels of urineβ2 microglobulin, C-reactive protein (CRP), and pro-inflammatory cytokines (Fig. 2a and Fig. 2d). However, chronic systemic inflammation was not completely controlled since the levels of inflammatory cytokines, erythrocyte sedimentation rate (ESR), and serum amyloid A (SAA) were still increased.