Skip to main content
Erschienen in: Pediatric Rheumatology 1/2024

Open Access 01.12.2024 | Research article

Long noncoding RNAs (CTC-471J1.2, NeST) as epigenetic risk factors of active juvenile lupus nephritis: a case-control study

verfasst von: Mohamed M. Zedan, Ali Sobh, Alshimaa Magdy, Mai S. Korkor, Zeinab R. Attia, Nada Khaled, Yousra Sadeq, Ahmed Hazem El-Nagdy, Ahmed E. Taha, Mohamed Ahmed Noureldin, Mohamed Taman, Doaa Mosad Mosa, Marwa H. Elnagdy

Erschienen in: Pediatric Rheumatology | Ausgabe 1/2024

Abstract

Background

Measurement of the circulating levels of long-non-coding RNAs (lncRNAs) in lupus nephritis (LN) patients could dramatically explore more insights about the disease pathogenesis. Hence, we aimed to quantify the level of expression of CTC-471J1.2 and NeST in LN patients and to correlate it with the disease activity.

Method

This case-control study was conducted on a group of children with juvenile LN attending to Mansoura University Children’s Hospital (MUCH). Demographics, clinical, and laboratory findings were collected besides the measurement of lncRNAs by quantitative real-time PCR.

Results

The expression level of lncRNAs-CTC-471J1.2 was significantly down-regulated in children with active LN versus inactive cases or controls. In contrast, the NeST was significantly up-regulated in active LN cases. A significant correlation was found between CTC-471J1.2 expression and LN activity parameters. Additionally, both lncRNAs showed a reasonable sensitivity and specificity in differentiation of active LN. A regression analysis model revealed that CTC-471J1.2 and NeST were independent predictors of active nephritis.

Conclusion

The expression level of circulatory lncRNAs-CTC-471J1.2 and NeST can be used as sensitive and specific biomarkers for active LN. Furthermore, both could serve as predictors for nephritis activity.
Hinweise
Mohamed M. Zedan and Ali Sobh are equal first authors.
Doaa Mosad Mosa and Marwa H. Elnagdy are equal last authors.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Abkürzungen
ANAs
Antinuclear antibodies
AUC
Area under curve
CBC
Complete blood count
CRP
C-reactive protein
eGFR
Estimated glomerular filtration rate
ESR
Erythrocyte sedimentation rate,
EULAR/ACR
European League Against Rheumatism/American College of Rheumatology
ISN
International Society of Nephrology
JSLE
Juvenile systemic lupus erythematosus
LincRNAs
Long intergenic non-coding RNAs
LN
Lupus nephritis
lncRNAs
Long-non-coding RNAs
MUCH
Mansoura University Children’s Hospital
NeST
Nettoie Salmonella pas Theiler’s
NIH
National Institutes of Health
PBMCs
Peripheral blood mononuclear cells
qRT-PCR
Quantitative real-time polymerase chain reaction
ROC
Receiver operating characteristic
RPS
Renal Pathology Society
SD
Standard deviation
SLEDAI-2K
SLE Disease Activity Index 2000
SLICC/ACR
Systemic Lupus International Collaborating Clinics/ACR
SPSS
Statistical package for social science
Tmevpg1
Theiler’s murine encephalomyelitis virus persistence candidate gene 1

Introduction

Juvenile systemic lupus erythematosus (JSLE) is a systemic heterogeneous autoimmune disease characterized by various clinical manifestations involving different tissues [1]. Lupus nephritis (LN), which is considered one of the most severe manifestations of SLE, affects up to 70% of children with a significant impact on the disease outcome [2]. SLE complex pathogenesis has not been fully elucidated, there is a possible association of SLE with environmental factors, genetic, epigenetic expression, innate, and adaptive immunity ends with immune complexes deposition in the tissues [3, 4].
Conventional immunological serum biomarkers cannot offer specificity and/or sensitivity for full LN assessment and renal biopsy is still the gold standard to confirm the diagnosis, disease staging, and severity assessment [5].
More than 80% of the human genome is transcribed into RNA transcripts without protein-coding potential. These long-non-coding RNAs (lncRNAs) are long RNA segments longer than 200 nucleotides. They are located in either the nucleus or cytoplasm. They can affect gene expression by different mechanisms through interactions with transcription factors or epigenetic modifiers [6]. Measurement of plasma or serum levels of lncRNAs makes them potential and non-invasive biomarkers for the assessment of disease activity and prognosis [7].
There are different lncRNAs that can be used as a new hotspot in SLE. They are accurate biomarkers with high throughput, some of them can be beneficial in diagnosis, and others could serve as next-generation biomarkers to differentiate SLE patients with LN from those without [8].
CTC-471J1.2 is an example of lncRNAs located on chromosome 19. It has been shown to exhibit high sensitivity and specificity as a diagnostic marker for LN. Expression of CTC-471J1.2 has been shown to display a negative correlation with disease activity scores in all SLE patients and a positive correlation with estimated glomerular filtration rate (eGFR) only in LN patients [9].
The lncRNA Nettoie Salmonella pas Theiler’s (NeST) formally known as Theiler’s murine encephalomyelitis virus persistence candidate gene 1 (Tmevpg1) is an enhancer-like lncRNA. It is expressed in T helper 1 cells, CD8+ T cells, and natural killer cells. It is located adjacent to the interferon gamma (IFN-γ) encoding gene so, its expression leads to the enhancement of IFN-γ production and that could participate in the pathogenesis of SLE [10].
The assessment of the circulating levels of lncRNAs in juvenile LN patients could dramatically explore more insights into the disease pathogenesis. Hence, we aimed with this study to evaluate the expression of CTC-471J1.2 and NeST in LN patients and to evaluate whether their expression may play a role in the pathogenesis of the disease.

Methods

Subjects

This case-control study was conducted on 61 patients who attended to Mansoura University Children’s Hospital (MUCH), Mansoura, Egypt diagnosed with JSLE and forty age and sex-matched healthy children as controls. It was done in the period from August 2021 to October 2022. Cases were classified according to the 2019 European League Against Rheumatism/American College of Rheumatology (EULAR/ACR) classification criteria for SLE [11].
Inclusion criteria:
1.
JSLE patients with lupus nephritis. Diagnosis of LN was defined as children with proteinuria > 0.5 g /24 h and/or proteinuria > 3+ and/or cellular casts (erythrocyte, granular, tubular, or mixed) and confirmed by renal biopsy [12].
 
2.
Patient whose parents gave informed consent to be included in the study.
 
Exclusion criteria:
Cases with SLE without lupus nephritis, patients who had other conditions can affect the expression of these epigenetic factors as diabetes mellitus, malignancies, or those with a diagnosis of other connective tissue diseases.

Data collection

Data were collected from our medical files and interpreted with respect to the demographic, clinical, disease assessment parameters, and laboratory features of the disease as follow:
1.
Disease assessment including, JSLE disease activity and cumulative damage was measured using the SLE Disease Activity Index 2000 (SLEDAI-2 K) [13] and the Systemic Lupus International Collaborating Clinics/ACR (SLICC/ACR) Damage Index [14]. No activity (SLEDAI = 0), mild activity (SLEDAI = 1–5), moderate activity (SLEDAI = 6–10), high activity (SLEDAI > 10) [15].
 
2.
Renal SLEDAI, which consists of the four kidney related parameters of the SLEDAI-2 K: haematuria, pyuria, proteinuria, and urinary casts, each item in the renal SLEDAI is assigned four points. Thus, scores for the renal SLEDAI can range from 0 to a maximum of 16 [13].
 
3.
Pathological grading of LN is categorized according to the International Society of Nephrology (ISN) and Renal Pathology Society (RPS) 2003 criteria [16]. Active LN defined as LN class III/IV with National Institutes of Health (NIH) activity index ≥ 10. NIH activity index score ranges 0 – 24. This activity score is based on the histological characteristics of active inflammation: endocapillary hypercellularity with/without leukocyte infiltration, karyorrhexis (fibrinoid necrosis), rupture of the basement membrane, fibrocellular crescents, subendothelial deposits (wire loops), and intraluminal immune aggregates (hyaline thrombi). NIH chronicity index score ranges 0 –12. The chronicity index reflects the damage features: glomerular sclerosis (segmental or global), fibrous adhesions or fibrous crescents, interstitial fibrosis, and tubular atrophy [17].
 
4.
Laboratory investigations:
a)
Complete blood count (CBC), erythrocyte sedimentation rate (ESR), C-reactive protein (CRP), liver function tests, serum creatinine, complement (low C3 < 90 mg/dl, low C4 < 8 mg/dl), urine analysis, antinuclear antibodies (ANAs), anti-dsDNA, 24-h urine analysis for proteinuria, as classical diagnostic biomarkers for Lupus and LN.
 
 

Sample size calculation

All eligible cases were collected along the study duration according to the inclusion criteria (convenient samples).

Sample collection for analysis of lncRNAs expression

Two millilitres of blood were collected in EDTA-containing blood collection tubes from all subjects participating in this study and transferred immediately to the Medical Biochemistry and Molecular Biology Department, Mansoura Faculty of Medicine. Peripheral blood mononuclear cells (PBMCs) were isolated from blood samples using Ficoll-Hypaque density-gradient centrifugation and used for the separation of lncRNAs. Total RNA extraction was done using QIAzol Lysis Reagent in accordance with the manufacturer′s specifications (QIAGEN, Germany). The RNA concentration and purity were checked by Thermo Scientific NanoDrop One. Reverse transcription of 1ug of RNA was done using SensiFAST™ cDNA Synthesis Kit (Bioline, UK) on Applied Biosystems Proflex Thermal Cycler. cDNA templates were amplified using a real-time PCR instrument (Azure Cielo 6, Azure, USA) and primers specific for CTC-471J1.2 and NeST amplifications.
Quantitative real-time polymerase chain reaction (qRT-PCR) was done in 20 μl total reaction volume [10 μl of Bioline SYBR green PCR Master Mix (Bioline, UK), 1 μl of cDNA template, 1 μl (10 pmol/μl) for each forward and reverse gene primers, and 7 μl of nuclease-free water] using the following program: initial denaturation at 95 °C for 2 min followed by 40 cycles of 95 °C for 10 s and 60 °C for 30 s. β-actin was used as an endogenous reference gene to normalize the lncRNA expression levels.
The primer sets were designated using Primer3Plus software (http://​www.​bioinformatics.​nl/​cgi-bin/​primer3plus/​primer3plus.​cgi), and primer specificity was checked using Primer-BLAST program (NCBI/ primer-BLAST (https://​www.​ncbi.​nlm.​nih.​gov/​tools/​primer-blast/​). Primers were purchased from Vivantis (Vivantis Technologies, Malaysia).
The sequences of the used primer pairs are supplied on Table 1. The specificity of each primer was confirmed by the presence of a single sharp peak by melting curve.
Table 1
The sequence of human primers used in qRT-PCR analysis
Gene
Sequence
Product size
CTC-471J1.2
Forward primer: ACAAATCTGAAAATACCACCTTG
Reverse primer: TTTCCTAGAAATCATTTAACCCA
106 bp
NeST
Forward: AAGTTCTGGGCTTCTCCTCC
Reverse: GACTTCAAAGAGTCTGAGGT
281 bp
β-actin
Forward: GTGGCCGAGGACTTTGATTG
Reverse: GTGGGGTGGCTTTTAGGATG
104 bp
The relative expression levels of CTC-471J1.2 and NeST genes were calculated by ΔΔCt method, and the fold change of gene expression was expressed as 2−ΔΔCT [18].

Statistical analysis

Using IBM SPSS (Statistical package for social science) version 24 for Windows, data were coded, computed, and analyzed:
Several variables were recoded to improve the analysis’s strength:
  • ❖ Descriptive statistics: were used to describe the demographic data, clinical and laboratory presentations of the cases
  • ❖ Qualitative data were displayed using frequency tables (Number and percentages).
  • ❖ For quantitative variables, the one-sample Kolmogorov-Smirnov test was used to determine the data’s normality before the data were displayed by central indices and dispersion:
Standard deviation (SD) and mean for variables with normally distributed data. Median and range (Minimum-Maximum) for variables with non-normal distribution.
  • ➢ Analytical statistics:
    • ❖ Chi-square test and Fischer exact test were used for categorical variables, to compare between different groups as appropriate. To compare two groups under study, the student t test was applied to parametric quantitative variables while the Mann Whitney test was applied to non-parametric quantitative data.
    • ❖ Kruskal Wallis test; to compare between more than two studied groups when comparing non-parametric quantitative variables.
    • ❖ Sensitivity and specificity analysis were performed and Receiver operating characteristic (ROC) curve was plotted to assess the impact of LncRNAs (CTC-471J1.2, NeST) levels on disease activity
    • ❖ The analysis of binary logistic regression was performed to predict the independent factors of disease activity. Calculated odds ratios with a 95% confidence interval were adjusted odds ratios.
  • ➢ Level of significance: For each statistical test, a result was deemed significant when the chance of error was 5% or less (p ≤ 0.05).

Results

The demographic, clinical, and laboratory data of JSLE participants

Sixty-one JSLE patients enrolled in the study. Demographic, and clinical characteristics for patients are shown in Fig. 1 and Table 2. The majority of cases were males (75.4%). It is known males carry poor prognosis for kidney involvement as we strictly include SLE cases with LN. The mean age of cases was 13.8 years ± 2.56 SD, whereas the mean age of the disease onset was 11.3 ± 2.29 years, and the disease duration was between 0.1–7 years with a median of 2 years. The median SLEDAI was 0- 21 with a median of 4, while renal SLEDAI was 0–16 with a median of 2. The laboratory findings and medical therapy of the studied cases are summarized in Table 3. The mean of serum creatinine was 0.64 ± 0.21 SD, and that of complement was 98.4 ± 25.8 SD. Leucopenia was detected in 3 cases and thrombocytopenia in 2 cases. Patients were subdivided into two subgroups: 45 SLE patients with inactive nephritis and 16 SLE patients with active nephritis. Subsequently, we compared the patients’ subgroups in (Table 4), and our results revealed no statistically significant difference was found among the patients’ subgroups regarding the demographic, clinical, laboratory characteristics or the medical therapy (P > 0.05).
Table 2
Demographic, characteristic, damage index, and nephritis histopathology of juvenile systemic lupus erythematosus (JSLE) patients
Parameter
JSLE patients (n = 61)
Age /y: (mean ± SD)
13.8 ± 2.56
Sex (Male / Female): N (%)
46 (75.4)/15 (24.6)
BMI: n (%)
 Underweight (Less than the 5th percentile)
1 (1.6)
 Normal (5th percentile to less than the 85th percentile)
43 (70.5)
 Overweight (85th percentile to less than the 95th percentile)
14 (23)
 Obese (95th percentile or greater)
3 (4.9)
Age of disease onset/y: (mean ± SD)
11.3 ± 2.29
Duration of disease/y: (median (range))
2 (0.1–7)
SLEDAI-2K: (median (range))
4 (0–21)
Disease activity status: n (%)
 High disease activity
21 (34.5)
 Low disease activity
32 (52.5)
 Inactive disease
8 (13)
SLICC/ACR-Damage Index: (median (range))
0 (0–0)
Nephritis: (mean ± SD)
3.03 ± 1.03
 Class I: n (%)
5 (8.2)
 Class II: n (%)
15 (24.6)
 Class III: n (%)
15 (24.6)
 Class IV: n (%)
25 (41)
 Class V: n (%)
1 (1.6)
Active lupus nephritis: n (%)
 No
45 (73.8)
 Yes
16 (26.2)
Activity index: (median (range))
6 (0–10)
Chronicity index: (median (range))
1 (0–4)
Renal SLEDAI: (median (range))
2 (0–16)
Values reported as median (range), percentile, and mean ± SD
Abbreviations: n Number, y Year, JSLE Juvenile systemic lupus erythematosus, BMI Bone mass index, SLEDAI Systemic Lupus Erythematosus Disease Activity Index, SLICC/ACR damage index Systemic Lupus International Collaborating Clinics/American Colleague of Rheumatology
Table 3
The laboratory findings and medical therapy in JSLE patients
Laboratory findings/Medical therapy
JSLE (n = 61)
24h urine protein (gm/dl): (median (range))
0.18 (0.1–5)
Serum creatinine (mg/dL): (mean ± SD)
0.64 ± 0.21
ESR (mm/hour): (mean ± SD)
36 ± 21.7
Complement (mg/dL): (mean ± SD)
98.4 ± 25.8
Anti-dsDNA (IU/mL): (mean ± SD)
548 ± 380.3
Anemia (< 10 g/dl): n (%)
 No
48 (78.7)
 Yes
13 (21.3)
Leucopenia (< 5 × 103/ µL): n (%)
 No
58 (95)
 Yes
3 (5)
Thrombocytopenia (< 150 × 10 3/µL): n (%)
 No
59 (96.7)
 Yes
2 (3.3)
Elevated liver enzymes: n (%)
 No
56 (92)
 Yes
5 (8)
APL antibodies: n (%)
 Negative
50 (82)
 Positive
11 (18)
Medications: n (%)
 Steroid + Hydroxychloroquine
18 (29.5)
 Steroid + Hydroxychloroquine + CYC
17 (27.9)
 Steroid + Hydroxychloroquine + MMF
9 (14.8)
 Steroid + Hydroxychloroquine + CYC + MMF
17 (27.9)
Values reported as median (range), percentile, and mean ± SD
Abbreviations: n Number, SLE Juvenile Systemic Lupus Erythematosus, ESR Erythrocyte Sedimentation Rate, APL Anti-phospholipid Antibodies, CYC Cyclophosphamide, MMF Mycophenolate Mofetil
Table 4
Comparison between active and inactive lupus nephritis (LN) regarding clinical presentations and laboratory findings
Parameter
Inactive LN (n = 45)
Active LN (n = 16)
Test of Significance
Sex
 Male
34 (75.6)
12 (75)
FET
P = 1
 Female
11 (24.4)
4 (25)
Fever
 Absent
29 (64.4)
7 (43.8)
x2 = 2.1
P = 0.15
 Present
16 (35.6)
9 (56.3)
Mucocutaneous
 Absent
23 (51)
5 (31.2)
X2 = 1.87
P = 0.17
 Present
22 (49)
11 (68.8)
Arthritis
 Absent
32 (71)
11 (68.8)
FET
P = 1
 Present
13 (29)
5 (31.2)
Serositis
 Absent
32 (71)
10 (62.5)
FET
P = 0.54
 Present
13 (29)
6 (37.5)
Vasculitis
 Absent
45 (100)
14 (87.5)
FET
P = 0.06
 Present
0.0
2 (12.5)
Medications
 2 medications
16 (35.6)
2 (12.5)
FET
P = 0.11
 > 2 medications
29 (64.4)
14 (87.5)
Anemia
 Absent
33 (73.3)
15 (93.8)
FET
P = 0.15
 Present
12 (26.7)
1 (6.3)
Leucopenia
 Absent
42 (93.3)
16 (100)
FET
0.56
 Present
3 (6.7)
0.0
Thrombocytopenia
 Absent
44 (97.8)
15 (93.8)
FET
P = 0.45
 Present
1 (2.2)
1 (6.3)
Liver function test
 Normal
42 (93.3)
14 (87.5)
FET
P = 0.6
 Elevated
3 (6.7)
2 (12.5)
APL antibodies
 Negative
36 (80)
14 (87.5)
FET
P = 0.7
 Positive
9 (20)
2 (12.5)
Values reported as percentile
P > 0.05 is considered statistically not significant
Abbreviations: n Number, LN Lupus nephritis, APL Anti-phospholipids antibodies, FET Fischer exact test, X2 Chi square test

Expression levels of LncRNAs (CTC-471J1.2, NeST) in the studied subjects

Expression profiling of lncRNAs-CTC-471J1.2 in PBMCs from inactive and active lupus nephritis patients showed a significant decrease as compared to controls (P1 = 0.02, P2 < 0.001, respectively). In contrast, the expression pattern of NeST was significantly increased in patients with inactive or active lupus nephritis (P1, P2 < 0.001) as compared to controls. Furthermore, the expression level of CTC-471J1.2 was significantly increased (P < 0.001) in patients with inactive lupus nephritis than in those with active lupus nephritis. The patients with inactive LN also displayed a significantly lower (P < 0.001) level of NeST expression than the active LN group (Table 5, Fig. 2).
Table 5
Comparison of the expression level of CTC-471J1.2 and NeST among inactive, active lupus nephritis patients, and controls
Parameter
Inactive LN (n = 45)
Active LN (n = 16)
Controls (n = 40)
Test of significant
CTC-471J1.2
0.54 (0.07–1.3)
0.14 (0.03–0.5)
0.9 (0.25–1.1)
P1 = 0.02*
P2 < 0.001*
KW
P < 0.001*
NeST
2.2 (1.1–5)
3.4 (1.7–5.7)
1.1(0.3–1.8)
P1 < 0.001*
P2 < 0.001*
KW
P < 0.001*
Values reported as median (min-max)
Abbreviations: n Number, LN Lupus nephritis, KW Kruskal-Wallis test used to compare non-parametric variables, P1 Significant difference between inactive lupus and controls, P2 Significant difference between active lupus and controls, P Significant difference between inactive and active lupus
*P, *P1, *P2 < 0.05 are considered statistically significant

Correlation between LncRNAs (CTC-471J1.2, NeST) expression levels and characteristics of lupus disease activity parameters

Detailed correlation analysis of CTC-471J1.2 and NeST levels with various clinical and laboratory parameters of the studied subjects are listed in Table 6. LncRNA-CTC-471J1.2 were negatively correlated with renal SLEDAI (r = -0.3, P = 0.04), 24-h urine protein (r = -0.3, P = 0.013), Anti-dsDNA titer (r = -0.27, P = 0.048) and NeST expression level (r = -0.46, P < 0.001). In contrast, the expression level of CTC-471J1.2 had a significantly positive correlation with complement (r = 0.28, P = 0.007). Regarding the expression level of NeST, there was no significant correlation with the SLE clinical or laboratory features (P > 0.05).
Table 6
Correlation between the expression level of CTC-471J1.2 and NeST and characteristics of SLE disease activity
Parameter
CTC-471J1.2
NeST
r (P- value)
 Renal SLEDAI
-0.3 (0.04)*
-0.2 (0.2)
 SLEDAI-2K
-0.05 (0.7)
-0.16 (0.3)
 Disease activity status
0.06 (0.9)
0.26 (0.09)
 24 h urine protein(gm/dl)
-0.3 (0.013)*
0.12 (0.37)
 Complement
0.28 (0.007)*
-0.36 (0.09)
 Anti-dsDNA
-0.27 (0.048)*
0.08 (0.54)
NeST
-0.46 (< 0.001)*
-
Abbreviations: SLE Systemic lupus erythematosus, SLEDAI Systemic Lupus Erythematosus Disease Activity Index, Anti-ds-DNA Anti-double-stranded DNA, r Spearman correlation coefficient
*P < 0.05 is considered statistically significant

ROC curve analysis

To investigate the diagnostic utility of lncRNAs-CTC-471J1.2 and NeST in differentiation of active LN cases, we found the following: CTC-471J1.2 at a cut-off value of 0.25 provided a sensitivity of 85% and a specificity of 83% with an area under curve (AUC) of 0.84. NeST sensitivity was 80% and specificity of 71% at the cut-off point of 2.75 with AUC of 0.83. It was found that the combined utilization of lncRNAs-CTC-471J1.2 and NeST had sensitivity of 93%, specificity of 77% with AUC of 0.92 (Table 7, Fig. 3).
Table 7
Sensitivity analysis/ROC curve of CTC-471J1.2, NeST expression levels to discriminate disease activity
Parameter
AUC
Cut off
Sensitivity
Specificity
95% CI
P-value
CTC-471J1.2
0.84
0.25
85%
83%
(0.72–0.94)
< 0.001*
NeST
0.83
2.75
80%
71%
(0.725–0.966)
< 0.001*
Combined: (CTC-471J1.2, NeST)a
0.92
-
93%
77%
(0.85–0.98)
< 0.001*
AUC Area Under Curve, CI Confidence Internal
*P < 0.05 is considered statistically significant
aAssessed by saved probabilities of logistic regression

Logistic regression analysis of lncRNAs (CTC-471J1.2, NeST) levels for prediction of active lupus nephritis

This analysis revealed that CTC-471J1.2 and NeST were found as independent predictors of disease activity (Table 8).
Table 8
Logistic regression analysis of CTC-471J1.2, NeST expression levels with the presence of active lupus nephritis
 
Regression coefficient
P value
Odds ratio (OR)
95% CI
CTC-471J1.2
-5.74
0.012*
3.18
(1.24–7.8)
NeST
1.16
0.02*
0.003
(0–0.39)
Constant
-1.07
Predicted%
83.6%
Model χ2
12.1, P = 0.001*
CI Confidence Internal
*P < 0.05 is considered statistically significant

Discussion

JSLE is a multisystem autoimmune disease with inflammatory consequences. It shows marked heterogeneity between patients, causing manifestations ranging from mild to severe [19]. LN is one of the most severe manifestations of SLE associated with considerable morbidity and mortality [2]. Dysregulation of lncRNAs function has been identified in cancer as well as autoimmune diseases via different mechanisms to alter encoding gene expression [20, 21]. There is mounting evidence that the lncRNAs’ expression plays a significant role in the pathogenesis of SLE and lupus nephritis by acting as a regulator of immune and inflammatory response [22]. It can also be used as a tool for evaluating renal outcome of LN patients [23].
In the current study, we aimed to investigate the expression of lncRNA-CTC-471J1.2 and NeST in pediatric lupus nephritis patients. Regarding CTC-471J1.2 expression, it was significantly downregulated in LN cases compared to controls, with higher level of expression among inactive LN patients than active LN group. Likewise, findings of Luo et al., 2018 who proposed that the downregulation in the expression level of lncRNAs including CTC-471J1.2 was associated with biological processes, cellular components, and molecular function, which affects several gene pathways, such as cytokine-cytokine receptor interaction, TNF signalling pathway, MAPK signalling pathway, and NF-κB signalling pathways [24].
Saleh et al., 2019 reported in agreement with our results that the cell-free lncRNA-CTC-471J1.2 was considered a potential biomarker for the diagnosis of SLE. It was revealed to be the most specific and sensitive diagnostic biomarker among the studied markers for lupus nephritis [9, 24]. By utilizing the ROC curve, CTC-471J1.2 appears to be a potential diagnostic biomarker for lupus nephritis activity, with high sensitivity (85%) and specificity (83%).
Moreover, there was a significant negative correlation between CTC-471J1.2 and SLE activity parameters, specifically renal SLEDAI, 24 h urine protein, and anti-dsDNA titres. This is in accordance to the results of Mihaylova et al., 2020 who found that CTC-471J1.2 expression levels has a negative correlation with SLEDAI scores in all SLE patients and a positive correlation with eGFR in only LN patients [25]. As the decrement of complement is a sign of disease activity [24], CTC-471J1.2 profile was positively correlated with its level. Our study reported a significant relationship between CTC-471J1.2 and NeST lncRNAs.
NeST is a long intergenic non-coding RNAs (lincRNAs) that function through transcriptional regulation. It is located near the IFN-γ-encoding gene in both mouse and human, and it can upregulate the expression of the IFN‑γ gene pathway [10]. It is known that IFN-γ plays a principal role in the development of proliferative LN [26] and it was significantly elevated in cases with active LN [27]. Hence, NeST was hypothesized to be involved in the pathogenesis of proliferative LN by regulating inflammatory chemokines and T-helper cells.
Compared with matched controls, NeST expression was upregulated among JSLE cases, with higher levels among our active LN cohort. This finding is running with the preceding report from Li et al. [28] and Xiao et al. [29]. Its level of expression was found to be upregulated in several immune diseases such as Sjögren syndrome and rheumatoid arthritis [30] as well.
However, NeST did not show any correlation with the various nephritis activity parameters. Nevertheless, the results of correlation should be considered with caution owing to the limited sample size. Further, on applying ROC curve for NeST, it displayed a lower sensitivity (80%) and specificity (71%) than CTC-471J1.2. Thus, concluding that lncRNA-CTC-471J1.2 seems to be a better epigenetic biomarker for LN activity as asserted by previous studies [9, 25].
On applying ROC curve for CTC-471J1.2 and NeST expression levels as biomarkers for disease activity, the sensitivity raised to 93% and we found that the panel of both significantly increased the AUC value to 0.92 compared with when they were utilized individually.
Regarding the potential for the development of active lupus nephritis, our study for the first time reported that CTC-471J1.2 and NeST work as significant predictors of active LN. Additionally, CTC-471J1.2 was shown to be a better predictor of disease activity than NeST as inferred from this prediction model.
There are some limitations of our study, the sample size was relatively small, we did not correlate between lncRNAs and the histological findings of LN nor did correlate them with other conditions with renal involvement, as post-streptococcal glomerulonephritis. Therefore, large-scale studies in different populations are pivotal to confirm our findings.

Conclusion

We found that the lncRNAs (CTC-471J1.2 and NeST) were preferentially expressed in LN. CTC-471J1.2 was significantly correlated with disease activity parameters, and it appears the most specific and sensitive diagnostic biomarker for nephritis. Furthermore, both CTC-471J1.2 and NeST could serve as predictors for lupus nephritis activity.

Acknowledgements

We are thankful to the participants and their parents for their cooperation.

Declarations

Institutional Research Board (IRB), Faculty of Medicine, Mansoura University, Egypt (R.20.08.982) approved this study.
Informed consent was obtained from all individual participants included in the study.
Patients gave informed consent regarding publishing the research results with data anonymization.

Competing interests

The authors have no competing interests to declare that are relevant to the content of this article. The authors have no relevant financial or non-financial interests to disclose.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://​creativecommons.​org/​licenses/​by/​4.​0/​. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Literatur
1.
2.
Zurück zum Zitat Borchers AT, Leibushor N, Naguwa SM, Cheema GS, Shoenfeld Y, Gershwin ME. Lupus nephritis: a critical review. Autoimmun Rev. 2012;12(2):174–94.CrossRefPubMed Borchers AT, Leibushor N, Naguwa SM, Cheema GS, Shoenfeld Y, Gershwin ME. Lupus nephritis: a critical review. Autoimmun Rev. 2012;12(2):174–94.CrossRefPubMed
3.
Zurück zum Zitat La Paglia GMC, Leone MC, Lepri G, Vagelli R, Valentini E, Alunno A, et al. One year in review 2017: systemic lupus erythematosus. Clin Exp Rheumatol. 2017;35(4):551–61.PubMed La Paglia GMC, Leone MC, Lepri G, Vagelli R, Valentini E, Alunno A, et al. One year in review 2017: systemic lupus erythematosus. Clin Exp Rheumatol. 2017;35(4):551–61.PubMed
4.
Zurück zum Zitat Novick D, Elbirt D, Miller G, Dinarello CA, Rubinstein M, Sthoeger ZM. High circulating levels of free interleukin-18 in patients with active SLE in the presence of elevated levels of interleukin-18 binding protein. J Autoimmun. 2010;34(2):121–6.CrossRefPubMed Novick D, Elbirt D, Miller G, Dinarello CA, Rubinstein M, Sthoeger ZM. High circulating levels of free interleukin-18 in patients with active SLE in the presence of elevated levels of interleukin-18 binding protein. J Autoimmun. 2010;34(2):121–6.CrossRefPubMed
5.
6.
Zurück zum Zitat Zuo Y, Xu H. Involvement of long noncoding RNAs in the pathogenesis of autoimmune diseases. J Transl Autoimmun. 2020;3:100044.CrossRef Zuo Y, Xu H. Involvement of long noncoding RNAs in the pathogenesis of autoimmune diseases. J Transl Autoimmun. 2020;3:100044.CrossRef
8.
Zurück zum Zitat Cao HY, Li D, Wang YP, Lu HX, Sun J, Li HB. Clinical significance of reduced expression of lncRNA TUG1 in the peripheral blood of systemic lupus erythematosus patients. Int J Rheum Dis. 2020;23(3):428–34.CrossRefPubMed Cao HY, Li D, Wang YP, Lu HX, Sun J, Li HB. Clinical significance of reduced expression of lncRNA TUG1 in the peripheral blood of systemic lupus erythematosus patients. Int J Rheum Dis. 2020;23(3):428–34.CrossRefPubMed
9.
Zurück zum Zitat Saleh A, Kasem HE, Zahran E, El-Hefnawy SM. Dysregulation of cell-free long non-coding RNAs (NEAT2, CTC-471J1.2 and lnc-DC) in Egyptian systemic lupus and lupus nephritis patients. Meta Gene. 2020;24:100665.CrossRef Saleh A, Kasem HE, Zahran E, El-Hefnawy SM. Dysregulation of cell-free long non-coding RNAs (NEAT2, CTC-471J1.2 and lnc-DC) in Egyptian systemic lupus and lupus nephritis patients. Meta Gene. 2020;24:100665.CrossRef
10.
Zurück zum Zitat Gomez JA, Wapinski OL, Yang YW, Bureau JF, Gopinath S, Monack DM, et al. The NeST long ncRNA controls microbial susceptibility and epigenetic activation of the interferon-γ locus. Cell. 2013;152(4):743–54.CrossRefPubMedPubMedCentral Gomez JA, Wapinski OL, Yang YW, Bureau JF, Gopinath S, Monack DM, et al. The NeST long ncRNA controls microbial susceptibility and epigenetic activation of the interferon-γ locus. Cell. 2013;152(4):743–54.CrossRefPubMedPubMedCentral
11.
Zurück zum Zitat Aringer M, Costenbader K, Daikh D, Brinks R, Mosca M, Ramsey-Goldman R, et al. European League Against Rheumatism/American College of Rheumatology classification criteria for systemic lupus erythematosus. Ann Rheum Dis. 2019;78(9):1151–9.CrossRefPubMed Aringer M, Costenbader K, Daikh D, Brinks R, Mosca M, Ramsey-Goldman R, et al. European League Against Rheumatism/American College of Rheumatology classification criteria for systemic lupus erythematosus. Ann Rheum Dis. 2019;78(9):1151–9.CrossRefPubMed
12.
Zurück zum Zitat Hochberg MC. Updating the American College of rheumatology revised criteria for the classification of systemic lupus erythematosus. Arthritis Rheum. 1997;40:1725.CrossRefPubMed Hochberg MC. Updating the American College of rheumatology revised criteria for the classification of systemic lupus erythematosus. Arthritis Rheum. 1997;40:1725.CrossRefPubMed
13.
Zurück zum Zitat Gladman DD, Ibanez D, Urowitz MB. Systemic lupus erythematosus disease activity index 2000. J Rheumatol. 2002;29:288–91.PubMed Gladman DD, Ibanez D, Urowitz MB. Systemic lupus erythematosus disease activity index 2000. J Rheumatol. 2002;29:288–91.PubMed
14.
Zurück zum Zitat Brunner HI, Silverman ED, To T, Bombardier C, Feldman BM. Risk factors for damage in childhood-onset systemic lupus erythematosus: cumulative disease activity and medication use predict disease damage. Arthritis Rheum. 2002;46(2):436–44.CrossRefPubMed Brunner HI, Silverman ED, To T, Bombardier C, Feldman BM. Risk factors for damage in childhood-onset systemic lupus erythematosus: cumulative disease activity and medication use predict disease damage. Arthritis Rheum. 2002;46(2):436–44.CrossRefPubMed
15.
Zurück zum Zitat Mosca M, Merrill JT, Bombardieri S. Chapter 2 - assessment of disease activity in systemic lupus erythematosus. In: Tsokos GC, Gordon C, Smolen JS, editors. Systemic lupus erythematosus. Philadelphia: Mosby; 2007. p. 19–23.CrossRef Mosca M, Merrill JT, Bombardieri S. Chapter 2 - assessment of disease activity in systemic lupus erythematosus. In: Tsokos GC, Gordon C, Smolen JS, editors. Systemic lupus erythematosus. Philadelphia: Mosby; 2007. p. 19–23.CrossRef
16.
Zurück zum Zitat Weening JJ, D’Agati VD, Schwartz MM, Seshan SV, Alpers CE, Appel GB, et al. The classification of glomerulonephritis in systemic lupus erythematosus revisited. Kidney Int. 2004;65(2):521–30.CrossRefPubMed Weening JJ, D’Agati VD, Schwartz MM, Seshan SV, Alpers CE, Appel GB, et al. The classification of glomerulonephritis in systemic lupus erythematosus revisited. Kidney Int. 2004;65(2):521–30.CrossRefPubMed
17.
Zurück zum Zitat Austin HA 3rd, Muenz LR, Joyce KM, Antonovych TA, Kullick ME, Klippel JH, et al. Prognostic factors in lupus nephritis. Contribution of renal histologic data. Am J Med. 1983;75(3):382–91.CrossRefPubMed Austin HA 3rd, Muenz LR, Joyce KM, Antonovych TA, Kullick ME, Klippel JH, et al. Prognostic factors in lupus nephritis. Contribution of renal histologic data. Am J Med. 1983;75(3):382–91.CrossRefPubMed
18.
Zurück zum Zitat Wu GC, Li J, Leng RX, Li XP, Li XM, Wang DG, et al. Identification of long non-coding RNAs GAS5, linc0597 and lnc-DC in plasma as novel biomarkers for systemic lupus erythematosus. Oncotarget. 2017;8(14):23650–63.CrossRefPubMedPubMedCentral Wu GC, Li J, Leng RX, Li XP, Li XM, Wang DG, et al. Identification of long non-coding RNAs GAS5, linc0597 and lnc-DC in plasma as novel biomarkers for systemic lupus erythematosus. Oncotarget. 2017;8(14):23650–63.CrossRefPubMedPubMedCentral
19.
Zurück zum Zitat Smith EMD, Lythgoe H, Midgley A, Beresford MW, Hedrich CM. Juvenile-onset systemic lupus erythematosus: update on clinical presentation, pathophysiology and treatment options. Clin Immunol. 2019;209:108274.CrossRefPubMed Smith EMD, Lythgoe H, Midgley A, Beresford MW, Hedrich CM. Juvenile-onset systemic lupus erythematosus: update on clinical presentation, pathophysiology and treatment options. Clin Immunol. 2019;209:108274.CrossRefPubMed
20.
Zurück zum Zitat Yougbaré I, Boire G, Roy M, Lugnier C, Rouseau E. NCS 613 exhibits anti-inflammatory effects on PBMCs from lupus patients by inhibiting p38 MAPK and NF-κB signalling pathways while reducing proinflammatory cytokine production. Can J Physiol Pharmacol. 2013;91(5):353–61.CrossRefPubMed Yougbaré I, Boire G, Roy M, Lugnier C, Rouseau E. NCS 613 exhibits anti-inflammatory effects on PBMCs from lupus patients by inhibiting p38 MAPK and NF-κB signalling pathways while reducing proinflammatory cytokine production. Can J Physiol Pharmacol. 2013;91(5):353–61.CrossRefPubMed
21.
Zurück zum Zitat Liu Q, Zhang X, Dai L, Hu X, Zhu J, Li L, et al. Long noncoding RNA related to cartilage injury promotes chondrocyte extracellular matrix degradation in osteoarthritis. Arthritis Rheumatol. 2014;66(4):969–78.CrossRefPubMed Liu Q, Zhang X, Dai L, Hu X, Zhu J, Li L, et al. Long noncoding RNA related to cartilage injury promotes chondrocyte extracellular matrix degradation in osteoarthritis. Arthritis Rheumatol. 2014;66(4):969–78.CrossRefPubMed
22.
Zurück zum Zitat Wu Y, Zhang F, Ma J, Zhang X, Wu L, Qu B, et al. Association of large intergenic noncoding RNA expression with disease activity and organ damage in systemic lupus erythematosus. Arthritis Res Ther. 2015;17(1):131.CrossRefPubMedPubMedCentral Wu Y, Zhang F, Ma J, Zhang X, Wu L, Qu B, et al. Association of large intergenic noncoding RNA expression with disease activity and organ damage in systemic lupus erythematosus. Arthritis Res Ther. 2015;17(1):131.CrossRefPubMedPubMedCentral
23.
Zurück zum Zitat Zhang F, Wu L, Qian J, Qu B, Xia S, La T, et al. Identification of the long noncoding RNA NEAT1 as a novel inflammatory regulator acting through MAPK pathway in human lupus. J Autoimmun. 2016;75:96–104.CrossRefPubMed Zhang F, Wu L, Qian J, Qu B, Xia S, La T, et al. Identification of the long noncoding RNA NEAT1 as a novel inflammatory regulator acting through MAPK pathway in human lupus. J Autoimmun. 2016;75:96–104.CrossRefPubMed
24.
Zurück zum Zitat Luo Q, Li X, Xu C, Zeng L, Ye J, Guo Y, et al. Integrative analysis of long non-coding RNAs and messenger RNA expression profiles in systemic lupus erythematosus. Mol Med Rep. 2018;17(3):3489–96.PubMed Luo Q, Li X, Xu C, Zeng L, Ye J, Guo Y, et al. Integrative analysis of long non-coding RNAs and messenger RNA expression profiles in systemic lupus erythematosus. Mol Med Rep. 2018;17(3):3489–96.PubMed
25.
Zurück zum Zitat Mihaylova G, Vasilev V, Kosturkova MB, Stoyanov GS, Radanova M. Long non-coding RNAs as new biomarkers in lupus nephritis: a connection between present and future. Cureus. 2020;12(7):e9003.PubMedPubMedCentral Mihaylova G, Vasilev V, Kosturkova MB, Stoyanov GS, Radanova M. Long non-coding RNAs as new biomarkers in lupus nephritis: a connection between present and future. Cureus. 2020;12(7):e9003.PubMedPubMedCentral
26.
Zurück zum Zitat Masutani K, Taniguchi M, Nakashima H, Yotsueda H, Kudoh Y, Tsuruya K, et al. Upregulated interleukin-4 production by peripheral T-helper cells in idiopathic membranous nephropathy. Nephrol Dial Transplant. 2004;19(3):580–6.CrossRefPubMed Masutani K, Taniguchi M, Nakashima H, Yotsueda H, Kudoh Y, Tsuruya K, et al. Upregulated interleukin-4 production by peripheral T-helper cells in idiopathic membranous nephropathy. Nephrol Dial Transplant. 2004;19(3):580–6.CrossRefPubMed
27.
Zurück zum Zitat Chan RW, Lai FM, Li EK, Tam LS, Chow KM, Lai KB, et al. Intrarenal cytokine gene expression in lupus nephritis. Ann Rheum Dis. 2007;66(7):886–92.CrossRefPubMedPubMedCentral Chan RW, Lai FM, Li EK, Tam LS, Chow KM, Lai KB, et al. Intrarenal cytokine gene expression in lupus nephritis. Ann Rheum Dis. 2007;66(7):886–92.CrossRefPubMedPubMedCentral
28.
Zurück zum Zitat Li Z, Chao TC, Chang KY, Lin N, Patil VS, Shimizu C, et al. The long noncoding RNA THRIL regulates TNF alpha expression through its interaction with hnRNPL. Proc Natl Acad Sci U S A. 2014;111(3):1002–7.CrossRefPubMed Li Z, Chao TC, Chang KY, Lin N, Patil VS, Shimizu C, et al. The long noncoding RNA THRIL regulates TNF alpha expression through its interaction with hnRNPL. Proc Natl Acad Sci U S A. 2014;111(3):1002–7.CrossRefPubMed
29.
30.
Zurück zum Zitat Gao Y, Li S, Zhang Z, Yu X, Zheng J. The role of long non-coding RNAs in the pathogenesis of RA, SLE, and SS. Front Med (Lausanne). 2018;5:193.CrossRefPubMed Gao Y, Li S, Zhang Z, Yu X, Zheng J. The role of long non-coding RNAs in the pathogenesis of RA, SLE, and SS. Front Med (Lausanne). 2018;5:193.CrossRefPubMed
Metadaten
Titel
Long noncoding RNAs (CTC-471J1.2, NeST) as epigenetic risk factors of active juvenile lupus nephritis: a case-control study
verfasst von
Mohamed M. Zedan
Ali Sobh
Alshimaa Magdy
Mai S. Korkor
Zeinab R. Attia
Nada Khaled
Yousra Sadeq
Ahmed Hazem El-Nagdy
Ahmed E. Taha
Mohamed Ahmed Noureldin
Mohamed Taman
Doaa Mosad Mosa
Marwa H. Elnagdy
Publikationsdatum
01.12.2024
Verlag
BioMed Central
Erschienen in
Pediatric Rheumatology / Ausgabe 1/2024
Elektronische ISSN: 1546-0096
DOI
https://doi.org/10.1186/s12969-023-00945-1

Weitere Artikel der Ausgabe 1/2024

Pediatric Rheumatology 1/2024 Zur Ausgabe

Mit dem Seitenschneider gegen das Reißverschluss-Malheur

03.06.2024 Urologische Notfallmedizin Nachrichten

Wer ihn je erlebt hat, wird ihn nicht vergessen: den Schmerz, den die beim Öffnen oder Schließen des Reißverschlusses am Hosenschlitz eingeklemmte Haut am Penis oder Skrotum verursacht. Eine neue Methode für rasche Abhilfe hat ein US-Team getestet.

Reanimation bei Kindern – besser vor Ort oder während Transport?

29.05.2024 Reanimation im Kindesalter Nachrichten

Zwar scheint es laut einer Studie aus den USA und Kanada bei der Reanimation von Kindern außerhalb einer Klinik keinen Unterschied für das Überleben zu machen, ob die Wiederbelebungsmaßnahmen während des Transports in die Klinik stattfinden oder vor Ort ausgeführt werden. Jedoch gibt es dabei einige Einschränkungen und eine wichtige Ausnahme.

Alter der Mutter beeinflusst Risiko für kongenitale Anomalie

28.05.2024 Kinder- und Jugendgynäkologie Nachrichten

Welchen Einfluss das Alter ihrer Mutter auf das Risiko hat, dass Kinder mit nicht chromosomal bedingter Malformation zur Welt kommen, hat eine ungarische Studie untersucht. Sie zeigt: Nicht nur fortgeschrittenes Alter ist riskant.

Begünstigt Bettruhe der Mutter doch das fetale Wachstum?

Ob ungeborene Kinder, die kleiner als die meisten Gleichaltrigen sind, schneller wachsen, wenn die Mutter sich mehr ausruht, wird diskutiert. Die Ergebnisse einer US-Studie sprechen dafür.

Update Pädiatrie

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.