Introduction
Lung cancer is a malignant tumor with the highest morbidity and mortality in the world [
1,
2]. At least the two main types of primary lung cancer, small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC) must be mentioned, with about NSCLC comprising 80–85% of lung cancers. Moreover, NSCLC are subgrouped into adenocarcinoma, squamous cell carcinoma, and large cell carcinoma. Given the insidious symptoms of this disease, most patients with lung cancer are already in the advanced stage when they visit the doctor, resulting in poor prognosis [
3]. Even after surgical treatment, the tumor is prone to recurrence and migration, leading to treatment failure and short survival time [
1]. With the deepening of the research on tumor pathogenesis, molecular targeted therapy has become a hot spot, such as tyrosine kinase inhibitors (TKIs) of epidermal growth factor receptor (EGFR) [
4]. Anaplastic lymphoma kinase fusion mutation is also a new molecular target for the treatment of non-small cell lung cancer (NSCLC) [
5]. However, some patients develop drug resistance and are unsuitable for molecular targeted therapy. The emergence of drug resistance greatly affects the use of targeted drugs [
6‐
8]. How to overcome the drug resistance and elucidate the underlying mechanism is the key problem.
Protease-activated receptors (PARs) can be expressed in some tumor cells [
9,
10]. PARs have been closely related to tumor growth and metastasis [
11]. PAR2 has been associated with tumor metastasis [
12]. After PAR2 is activated, it may transcriptionally activate a certain cytokine or change its expression. Activation of PARs causes signal transduction, leading to cell proliferation and migration [
13]. In MDA-MB-231 cells, the TF-FII A complex specifically upregulates the expression of IL-8 through PAR2, resulting in significantly enhanced cell migration [
14]. MMPs induce the production of transforming growth factor-α (TGF-α), which mediates the regulation of the activation of EGFR and the continuous phosphorylation of downstream MAPK, leading to cell proliferation and migration [
15]. However, the role of PAR2 in lung cancer, especially in lung cancer EMT and chemotherapeutic sensitivity, remains to be further studied.
Reversible EGFR-TKIs (gefitinib) are important targeted agents for the treatment of NSCLC [
16]. However, patients with primary drug-resistant EGFR-TKIS lung cancer cannot benefit from the treatment, leading to the continuous search for new treatment methods [
17]. Melittin is a small protein extracted from bee venom [
18]. Melittin has antibacterial, antiviral, anti-inflammatory, and analgesic effects [
19]. Melittin exerts inhibitory effects on various tumor cells, and its targets are diverse, including direct killing of cells, inhibition of cell proliferation, promotion of cell apoptosis, and inhibition of cell angiogenesis [
20‐
22].
In this study, we investigated the effects of melittin on the proliferation and apoptosis of NSCLC cells. The molecular mechanism by which melittin enhances the effect of gefinitib through PAR2 inhibition was also discussed. This study aims to find a safe and effective method for the clinical treatment of NSCLC.
Methods
Cell culture
The Normal human lung epithelial cells BEAS-2B and lung cancer cell lines H460, A549 and NCI-H1299 were purchased from American Type Culture Collection (ATCC, Manassas, VA, USA) and cultured in RPMI 1640 supplemented with 10% fetal bovine serum (FBS). The culture was placed in an incubator at 37 ℃ and 5% CO2. When the bottom of the culture flask was 70–80% full of cells, digestion and passage were performed. Cells in the logarithmic growth phase were used for subsequent experiments.
Cell transfection
Firstly, the siRNA and transfection reagent were prepared. The siRNA used was specifically designed for targeted silencing of PAR2. The sequences for the siRNA non-targeting control were as follows: forward: 5’-GCGACGAUCUGCCUAAGAUdTdT-3’, reverse: 5’-AUCUUAGGCAGAUCGUCGCdTdT-3’. For the siRNA targeting PAR2: si-PAR2#1: the sequence was 5ʹ-AAUGGCAUGGCCCUCUGGAUC (dTdT)-3ʹ. si-PAR2#2: the sequence was 5’-GCUCUGCAAGGUGCUCAUUGGCUUU-3’. For the transfection process, 100 μL of Opti-MEM was used as a medium. To this, the siRNA and transfection reagent were added. The mixture was gently pipetted to ensure a homogeneous distribution of the siRNA and transfection reagent within the Opti-MEM. Once the siRNA and transfection reagent were thoroughly mixed into the Opti-MEM, the mixture was allowed to stand for 10 min. This incubation period is crucial as it allows the formation of siRNA-lipid complexes, which are necessary for efficient transfection. Following the 10-min incubation, the siRNA-transfection reagent mixture was added dropwise to a 6-well plate containing the cells. Care was taken to distribute the drops evenly across the well to ensure uniform transfection. The cells were then cultured in a 10% FBS medium. The culture was placed in an incubator set at 37 ℃ and 5% CO
2. These conditions were maintained to ensure optimal cell growth and siRNA uptake. The cells were monitored regularly to assess the transfection efficiency and to ensure that the cells were not undergoing any adverse effects due to the transfection process. Since the transfection efficiency of the two siRNA was different, and si-PAR2#2 could not completely silence the expression level of PAR2 effectively, we selected si-PAR2#1 with high knockout efficiency for the subsequent experiment (Figure
S1).
CancerSEA website analysis
CancerSEA is a multi-functional website aimed at comprehensively exploring the different functional states of cancer cells at the single-cell level [
7,
23]. In this study, CancerSEA was used to investigate the correlation between different functional states of the PAR2 gene and lung cancer. An average association was observed between PAR2 and different functional states of lung cancer, including invasion, metastasis, proliferation, and EMT.
Human protein atlas analysis
In this study, the Human Protein Atlas [
24,
25] was used to analyze the expression level of PAR2 in normal lung tissues and lung cancer tissues. The correlation between different expression levels of PAR2 and prognosis of patients with lung cancer was analyzed.
qRT-PCR
Total RNA was extracted using the RNA extraction kit in accordance with the manufacturer’s instructions. It was then reverse-transcribed into cDNA using a reverse transcription kit. Fluorescence quantitative PCR was performed using Roche’s SYBR Green Master Mix. The Q-PCR reaction system was as follows (20 μL): 10 μL of SYBR qPCR Mix, 0.8 μL each of qPCR upstream and downstream primers (10 μmol/L), 2 μL of cDNA, 0.4 μL of 50 × Rox reference dye, and de-RNase water until 20 μL. Primers were synthesized by Sangon Biotech Co., Ltd. The sequences are displayed in Table
1. The reaction system on the machine detection was as follows: pre-denaturation at 95 ℃ for 1 min, followed by 95 ℃ for 30 s, 60 ℃ for 40 s, 40 cycles. All samples were tested three times with three parallel holes. Gene transcription level was corrected by GAPDH by using the 2
−ΔΔCT method.
Table 1
The sequences of the primers used in qRT-PCR
PAR2 | TTTCTCTCGGTGCGTCCAG | GTTCCTTGGATGGTGCCACT |
Oct4 | CTTGCTGCAGAAGTGGGTGGAGGAA | CTGCAGTGTGGGTTTCGGGCA |
SOX2 | CCCTGTGGTTACCTCTTCCTC | CGCTCTGGTAGTGCTGGGAC |
Nanog | AATACCTCAGCCTCCAGCAGATG | TGCGTCACACCATTGCTATTCTTC |
Snail1 | CCTCCCTGTCAGATGAGGAC | CCAGGCTGAGGTATTCCTTG |
Slug | GGGGAGAAGCCTTTTTCTTG | TCCTCATGTTTGTGCAGGAG |
Twist1 | GCAAGAAGTCGAGCGAAGAT | GCTCTGCAGCTCCTCGAA |
E-cadherin | TGCCCAGAAAATGAAAAAGG | GTGTATGTGGCAATGCGTTC |
Vimentin | GAGAACTTTGCCGTTGAAGC | GCTTCCTGTAGGTGGCAATC |
GAPDH | GGAGCGAGATCCCTCCAAAAT | GGCTGTTGTCATACTTCTCATGG |
Cell proliferation was detected by MTT
Cells in the logarithmic growth phase were collected. Cells at a density of 3 × 103 cells per well were inoculated into 96-well plates. After culture for 12 h, the supernatant was discarded. Melittin (1, 2, 4 mg/L) and 200 μL of gefitinib medium (1 μmol/L) were added to each well CCCCC [
26‐
28]. Then, 20 μL of MTT (5 mg/mL) was added to each well after 48 h in the incubator. The cells were cultured at 37 ℃ for 4 h and then added with 150 μL of DMSO. Before detection, the cells were shaken and mixed gently, and the enzyme-linked detector was used to detect the optical density value of each hole at the wavelength of 490 nm (D(450)). The cell proliferation inhibition rate was calculated according to the following formula: Inhibition rate of cell proliferation = ((optical density value of control group-optical density value of drug treatment group)/ optical density value of control group) × 100. The experiment was repeated three times.
Transwell experiment
Matrigel (serum-free medium) was diluted to the desired concentration by adding 30 μL of each Transwell chamber and allowed to set. Serum-free 1640 medium was used to adjust the cell concentration to 2 × 105 cells/mL. The upper and lower compartments of the Transwell chamber were added with 200 μL of cell suspension and 600 μL of RPMI 1640 containing 10% serum, respectively. The Transwell chambers were incubated for 48 h. Unmigrated cells on the membrane were gently wiped off using a cotton swab. The filter membrane was fixed with methanol for 30 min. The cells were stained with 0.1% crystal violet solution for 20 min. The number of cells crossing the membrane was counted and compared under a microscope. The total number of cells was counted in five fields of vision, namely, upper, lower, left, right, and middle, and averaged.
Cells in the logarithmic growth phase were inoculated into a 6-well plate at a cell density of 2 × 103 cells/well. After 24 h of culture, RPMI 1640 medium containing 1% FBS was replaced. Then, melittin or gefitinib was added in different concentrations. After 3 days of drug intervention, RPMI 1640 medium containing 10% FBS was replaced for further culture for 10 days. At the end of the experiment, the cells were washed once with phosphate-buffered saline. The samples were fixed with 0.5% crystal violet (prepared with 10% methanol) and stained for 15 min. The number of clones formed by the cells was recorded.
Western blot
Cells in each group were lysed with RIPA lysate (1 mL RIPA + 10μL PMSF + 10μL aprotinin) for 30 min and operated on ice. Protein concentration was measured by BCA method, and loading buffer was added to denatured protein. Prepare 10% SDS-PAGE and add 20 μg protein sample to each well. Use wet transfer to transfer to PVDF membrane. 5% skimmed milk powder was closed for 2 h. Primary antibody of PAR2 (ab180953, Abcam, Cambridge, MA, USA), Oct4 (ab200834), SOX2 (ab171380), Nanog (ab109250), Snail1 (ab31787), Slug (ab51772)), Twist1 (ab50887)), E-cadherin (ab40772), Vimentin (ab92547) was diluted at 1: 1000 TBST at 4 ℃ overnight. The 1: 5000 diluted secondary antibody was added and incubated for 2 h at room temperature. ECL luminescence kit was developed and analyzed after fixing.
Statistical analysis
Statistical analysis was performed using SPSS 17.0 statistical software. Measurement data were expressed as mean ± standard deviation. Student’s t-test was used for comparison between the two groups. One-way ANOVA followed by Tukey’s post-hoc test was used for multi-component comparison. Statistical significance was considered at P < 0.05.
Discussion
PARs, a family of protease-activated receptors, are G-protein-coupled receptors (GPCR). The PAR family, which has four members, plays an important role in vascular physiology, neural tube closure, hemostasis, and inflammation [
29]. PAR1 and PAR2 promote the invasion and metastasis of some type tumor cells by regulating cell migration and angiogenesis and interacting with platelets, fibroblasts cells [
30‐
33]. The regulatory effects of PAR2 on tumor progression are multifaceted. PAR2 activation promotes the release of vascular endothelial growth factor, interleukin-6, and interleukin-8, thereby promoting the formation and invasion of new blood vessels in malignant tumors [
34]. PAR2 is also necessary for coagulation factors VII A and PARA to induce the metastasis and invasion of breast cancer cells [
35]. In addition, PAR2 activation promotes the reversal of epidermal growth factor (EGF) and the release of TGF-α, induces tumor angiogenesis, and mediates the proliferation of gastric, colon, and esophageal cancer cells [
36].
In the present study, the mRNA levels of PAR2 significantly increased in NSCLC tissues compared with paracancerous tissues. The expression of PAR2 and its clinical significance were also studied in this study. Survival analysis showed that patients with high PAR2 expression had shorter overall survival than those with low PAR2 expression. Therefore, PAR2 in lung cancer tissue may be used as a molecular target for the prognosis of lung cancer patients, assisting in the clinical diagnosis and treatment of lung cancer to a certain extent. We further investigated whether or not PAR2 expression could affect the proliferation and invasion of NSCLC cells. We transfected si-PAR2, which could interfere with PAR2 expression, into NSCLC A549 and NCI-H1299 cells to obtain cell lines with low PAR2 expression. MTT assay results showed that the proliferation of PAR2 knockdown cells was significantly reduced compared with the control group. Transwell assay results also confirmed that PAR2 knockdown not only affected the proliferation of NSCLC cells but also significantly reduced their invasion compared with the control group. Moreover, PAR2 knockdown increased the inhibitory effect of gefitinib on lung cancer.
In this study, we examined the effects of melittin at different concentrations on the proliferation, invasion, and clone formation of NSCLC cells A549 and NCI-H1299. Results showed that low-dose melittin can effectively inhibit the proliferation of these cells in a dose-dependent manner. As one of the basic principles of tumor chemotherapy, drug combination aims to achieve synergistic effects, reduce drug dosage, and reduce adverse reactions [
37,
38]. In the present study, using the principle of neutral effect, lung cancer cell lines A549 and NCI-H1299 were used as research objects to study the interaction between melittin and gefitinib by inhibiting PAR2.
In the present study, melittin and gefitinib showed significant synergistic effects on lung cancer cell lines. Existing antitumor studies of melittin mostly focused on the inhibition of cell proliferation, induction of apoptosis, or inhibition of angiogenesis, but the underlying molecular mechanism remains to be elucidated. Results of this study revealed that melittin can inhibit the PAR2 pathway in NSCLC cells and thus inhibit EMT. Thus, melittin can be used to achieve better efficacy than gefitinib alone.
There are limitations to the study. Whether Melittin has other targets remains to be further studied. In addition, this study demonstrated the role of PAR2 in lung cancer and the antitumor effect of Melittin only at the cellular level. Melittin has not been proven to have an anti-tumor effect or to increase the anticancer effect of chemotherapy in vivo. The present study also lack of using multiple concentrations of PAR2 and Gefitinib for subsequent studies. In the future, we will consider experiments on drug-resistant lung cancer cell lines to further demonstrate the effect of Melittin on the improvement of gefitinib resistance by inhibiting PAR2.
Conclusion
PAR2 plays an important role in the occurrence and development of lung cancer. High expression of PAR2 promoted the proliferation, migration, and invasion of lung cancer cells and was significantly correlated with the drug resistance of lung cancer cells. Melittin enhanced the anticancer activity of gefitinib by inhibiting PAR2. The results of this study need to be explored in other types of tumor and validated in future clinical trials.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.