Background
Congenital dyserythropoietic anemias (CDAs) are a rare and heterogeneous group of disorders. CDAs are characterized by ineffective erythropoiesis, morphological abnormalities of erythroblasts (bi/multinucleated erythroblast, internuclear bridges, erythroid hyperplasia), haemolysis. Depending on erythroid maturation and precursors involved, three major types of CDA (I, II, III) are identified. Other variants of CDA like transcription factor-related CDA include CDA type IV and X-linked thrombocytopenia with or without dyserythropoietic anemia (XLTDA). The CDA associated with Majeed syndrome is also known. The causative genes are CDAN1, C15ORF41, SEC23B, KIF23, KLF1, GATA1, and LPIN2 [1]. Patients suffering from CDA are characterized by anemia of variable degree, pallor, recurrent jaundice, hepatomegaly, splenomegaly, and gall stones. In some cases, patients are transfusion-dependent, while in some cases, transfusion is less frequently required, and patients are asymptomatic [2].
Congenital Dyserythropoietic Anemia type II (OMIM: 224100) is the most common type of CDA. The genetic defect of CDAII is due to mutations in the SEC23B gene (encoding COPII) [3]. SEC23B gene (OMIM: 610512) is located on chromosome 20p11.23. It is involved in providing instructions for the making of one component of coat protein complex II (COPII). COPII is a large group of interacting proteins that function in the formation of vesicles. Vesicles are small sac-like structures involved in the transportation of proteins and other materials in cells. COPII triggers the formation of vesicles in the endoplasmic reticulum (ER). It plays a vital role in protein processing and transportation. COPII vesicles carry proteins that are destined to be secreted. Endoplasmic reticulum (ER)-to-Golgi trafficking is disturbed due to abnormalities in the SEC23B gene. This affects different glycosylation pathways and ultimately accounts for the cellular phenotype observed in CDAII [4].
Anzeige
SEC23B mutations are inherited in an autosomal recessive pattern. So far, only 16 patients of congenital dyserythropoietic anemia type II from India have been described in the literature: 6 of the patients were diagnosed based on bone marrow light microscopy [5], and 10 North Indian patients suspected of CDAII based on the clinical history and bone marrow light microscopy were confirmed to have p.Y462C mutation in exon 12 of SEC23B gene by molecular characterization using Sanger sequencing [6, 7]. There is a possibility of more patients suffering from CDA in the Indian population. But the data is not available because of difficulties in diagnosis. The current methods used for diagnosis include light and/or electron microscopic analysis of bone marrow aspirate[8], SDS-PAGE and molecular confirmation is carried out using next-generation sequencing (NGS) and Sanger sequencing. Next-generation sequencing and Sanger sequencing are time-consuming, laborious and comparatively costly methods. For the identification of common mutations other techniques like restriction fragment length polymorphism, high-resolution melting curve analysis can be used. More than 141 mutations have been identified in the SEC23B gene that cause CDA II. The most common mutation in the Indian population is c.1385 A > G, p.Y462C [9]. Many patients with CDA remain undiagnosed because of a lack of simple, confirmatory diagnostic methods.
Biochemical methods such as Eosin-5’-Maleimide assay (EMA) followed by an anti-CD44 antibody binding test, along with bone marrow microscopy and molecular tests, are found to be helpful for the diagnosis [10]. The Eosin-5’-Maleimide assay (EMA) is used for the diagnosis of red cell membrane protein defects. Patients suffering from CDA II have hypo-glycosylation of band 3 of the red cell membrane. Therefore, they show decreased mean channel fluorescence (MCF) in the EMA test. Thus, many cases of CDA II are misdiagnosed as cases of membrane protein defects like hereditary spherocytosis (HS). In CDA II patients, anti-CD44 antibody binding to red blood cells is raised compared to normal healthy individuals and HS patients [10, 11]. We used the Eosin-5’-Maleimide assay (EMA) by flow cytometry to diagnose hereditary spherocytosis and CDAII. We have further used an anti-CD44 antibody binding assay to suspect the diagnosis of CDA II in patients who have shown low mean channel fluorescence in the EMA test. Sanger sequencing was used for the confirmation of diagnosis and the utility of High-Resolution Melting (HRM) curve analysis was checked to identify the common mutation.
High-Resolution Melting (HRM) curve analysis is a polymerase chain reaction (PCR) based technique applied to identify genetic differences and scan nucleic acid sequences. The properties of DNA such as length, sequence, composition, GC content, and heterozygosity are responsible for the melting curve. Significant information about the genotype can be obtained by these melting curve profiles, which allow analysis of mutations and polymorphisms. The precision and accuracy of the HRM method are dependent on the fluorescent dye used along with the instrument and software in the analysis [12]. HRM analysis gives reproducible and rapid results though not used in routine clinical practice [13]. In this study, we have developed the HRM method to detect common SEC23B gene mutation causing CDA II in the Indian population.
Methodology
Blood collection, measurement of hematological parameters, and case history
A total of 11 suspected patients of CDA were referred to our haematogenetics laboratory of the National Institute of Immunohematology (NIIH), KEM Hospital, Mumbai, India. All patients were of Indian origin and were from genetically unrelated families. The available family members of 11 patients were included in this study. With the approval of ICMR- National Institute of Immunohematology- Ethics Committee guidelines, we took written informed consent from all the patients and their family members. We reviewed the patients’ family history and clinical, morphological, and laboratory data. The CDA was suspected based on clinical findings and in some patients based on bone marrow analysis. The complete blood count (CBC) using the automated haematology analyzer (Sysmex XN, Sysmex corporation) and morphological examination of red blood cells was performed. The confirmation of the diagnosis of CDA was done by molecular analysis using Sanger sequencing and newly developed High-Resolution Melting (HRM) curve analysis.
Anzeige
Eosin 5’ maleimide binding assay (EMA)
5µL washed packed red blood cells from all patients and healthy controls were mixed with 25µL of EMA dye (0.5 mg/mL in PBS) and incubated for an hour in the dark at room temperature. Phosphate Buffer Saline–bovine serum albumin (PBS-BSA) solution was used to wash EMA dye-labeled RBCs. Washed RBCs were then resuspended in 500 µL of PBS-BSA solution. 50µL of RBCs labelled with EMA were resuspended in 700 µL of 0.5% PBS-BSA solution for analysis on BD FACSAria™ Fusion Flow Cytometer. Results were expressed in Mean Channel Fluorescence (MCF) as described earlier for the diagnosis of red cell membrane protein defect [14]. As described in the literature, in this study also low or borderline MCF was observed in CDA II patients [10, 11].
CD44 antibody binding assay
10µL of whole blood was diluted with PBS (1:150 dilution). 30µL of this diluted sample was incubated with the titrated volume of anti-CD44 antibody (BD Biosciences) in the dark at room temperature for 20 min. CD44 labelled RBCs were then washed and resuspended in 300 µL of PBS and used for analysis on BD FACSAria™ Fusion Flow Cytometer, and results were expressed in MCF as described earlier [10].
Isolation of DNA and mutational analysis of SEC23B gene using sanger sequencing
FlexiGene kit was used for the isolation of genomic DNA from peripheral blood. Amplification of DNA for exon 12 of SEC23B gene was carried out using oligonucleotides primers [Exon-12F:5’TAGCCTGCCCTACTCAGTCA 3’ and Exon-12R: 5’ TGACTCCGACTAAACCCTTG 3’]. The primers are made using NCBI-Primer BLAST software (https://www.ncbi.nlm.nih.gov/tools/primer-blast/). The PCR conditions were: 950 C for 5 min (940 C for 20 sec, 580 C for 20 sec, 720 C for 20 sec) for 35 cycles and a final extension at 720 C for 5 min. QIAquick Gel Extraction Kit was used to purify the amplicons further, and purified products were used for mutation analysis. ABI PRISM BigDye Terminator Cycle Sequencing Ready Kit was used for sequencing purified PCR products, and they were run on an ABI Prism 3730xl Genetic Analyzer (Applied Biosystems, USA). CHROMAS software v2.6.6 was used to analyze the obtained chromatograms.
High-resolution melting (HRM) analysis for screening of SEC23B-Y462C mutation
Real-time PCR (Applied Biosystems StepOne™ Real-Time PCR) was used to perform High-Resolution Melting (HRM) assay for the screening of SEC23B-Y462C mutation. 10.0 µL of HRM Master Mix manufactured byMeltDoctor™, 0.4µL of forward primer (10 pmoles) [Exon-12F:5’TAGCCTGCCCTACTCAGTCA 3’] and 0.4µL of reverse primer (10 pmoles)[Exon-12R: 5’TGACTCCGACTAAACCCTTG 3’], 2.0 µL of DNA having concentration 50–100 ng,7.2 µL of HPLC water making a reaction mixture of 20.0 µLwas used for the assay. The cycling conditions were as follows: denaturation at 950 C for 10 min (950 C for 15 sec, 600 C for 1 min) for 40 cycles. The temperature was raised to 970 C following continuous fluorescence detection of 25 acquisitions for the development of melting curves [12]. StepOne Software v2.3 was used for the completion of all steps by using HRM Software v3.0.1 to carry out an analysis.
Results
Clinical data
11 CDA patients (8 males and 3 females) were included in our study. Their ages ranged from 3 months to 33 years. The median age was 12 years. Pedigree structure and segregation analysis of families affected by congenital dyserythropoietic anemia (CDA) are shown in (Fig. 1). The hematological, biochemical, and clinical manifestations in these patients are summarized in (Table 1). The clinical picture of all 11 patients showed recurrent jaundice, severe anemia, and hepatosplenomegaly of varying degrees, and most of the patients presented with weakness, fatigue, and recurrent stomach aches. Serum ferritin and lactate dehydrogenase (LDH) was increased in all the patients. Patients’ peripheral blood smear showed hypochromic cells, teardrop cells, and a few spherocytes, and the bone marrow smear showed erythroid hyperplasia, few bi &multinucleated erythroblasts, and mild dyserythropoiesis. Index case from family 1 had short stature and cushingoid features. The index case from family 2 had antinuclear antibody (ANA) positive, and the index case of family 8 had a congenital disorder of glycosylation along with congenital dyserythropoietic anemia.
Fig. 1
Pedigree structure and segregation analysis of families affected by congenital dyserythropoietic anemia (CDA). Individuals affected with CDAII p.Y462C homozygous mutation are indicated by a black-filled circle (females) or square (males). Heterozygous individuals are indicated by half-filled circles (females) and half-filled squares (males)
×
![]()
Table 1
Haematological, Biochemical and Clinical Profile of 11 Patients with CDA type II
Family | Proband | Age at diagnosis/ Sex | RBC (x106/ul) | Hb (g/dL) | HCT (%) | MCV (fl.) | MCHC (g/dL) | RDW (%) | Retic (%) | BM-LM | Presenting Symptoms | EMA (MCF) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
F1 | II – 2 | 5Y/M | 1.89 | 4.3 | 13.8 | 73 | 31.2 | 29.7 | 3 | Erythroid hyperplasia, few bi & multinucleated erythroblasts, occasional karyorrhectic forms, mild dyserythropoiesis | Chronic anemia, Hepato-Splenomegaly | 849 |
F2 | II – 1 | 33Y/M | 2.16 | 5.8 | 17.3 | 80.1 | 33.5 | 23 | 0.9 | Erythroid hyperplasia, binucleated erythroblasts, dyserythropoiesis | Pallor, Icterus, anemia Cholelithiasis, haemolytic facies | 593 |
F3 | II – 1 | 3 m/M | 2.7 | 7.5 | 20.7 | 76.7 | 36.2 | 15.2 | 9 | Not Done | Severe anemia, hepato-splenomegaly, neonatal jaundice | 886 |
F4 | II – 2 | 9 Y/ F | 2.64 | 6.9 | 19.1 | 72.3 | 36.1 | 27.3 | 8 | Erythroid Hyperplasia, binucleated erythroblasts | Chronic anemia, Hyperbilirubinemia | 630 |
F5 | II – 3 | 12Y/M | 2.66 | 7 | 21.5 | 80.8 | 32.6 | 30 | 4 | Not Done | Severe anemia, Icterus | 995 |
F6 | II – 1 | 9Y/ M | 1.65 | 6.2 | 18.3 | 110.9 | 33.9 | 20.7 | 2.4 | Erythroid Hyperplasia, a large number of bilobed erythroid cells, some nuclear bridging | Severe anemia, Neonatal Jaundice, splenomegaly | 850 |
F7 | II – 3 | 13Y/M | 3.33 | 8.3 | 24.4 | 73.3 | 34 | 24.8 | 1.3 | Not Done | Chronic haemolytic anemia, Icterus, Pallor, hepatosplenomegaly | 780 |
II – 2 | 18Y/F | 2.94 | 8.8 | 24.1 | 82 | 36.5 | 22.1 | 1.6 | Erythroid hyperplasia, mild dyserythropoiesis, multinucleated erythroblasts, karyorrhexis, nuclear bridging | Severe anemia, recurrent jaundice, pallor, chipmunk facies | 856 | |
F8 | II − 3 | 15Y/M | 3.68 | 9.9 | 32 | 87 | 30.9 | 26 | 5 | Not Done | Anemia, pallor, icterus, moderate splenomegaly | 754 |
F9 | II − 2 | 12Y/M | 3.0 | 7.4 | 22.5 | 75 | 32.9 | 21.7 | 0.1 | Dyserythropoietic normoblasts | Severe pallor, severe anemia, neonatal jaundice, splenomegaly | 918 |
F10 | II − 2 | 6 m/F | 1.8 | 4 | 12.8 | 71.1 | 31.3 | 29.1 | 2.8 | Not Done | Severe pallor, anemia, hemangioma | 926 |
Flow cytometric analysis of EMA binding assay and anti-CD44 antibody binding assay
A significant decrease in MCF using EMA binding assay was observed in 11 CDAII patients as shown in (Table 1). (Normal range: 900–1300 MCF units). The anti-CD44 antibody binding test using flow cytometric analysis was performed; positive results were obtained based on elevated mean channel fluorescence values compared to normal healthy individuals. All patients with CDAII showed almost twice MCF in the anti-CD44 antibody binding test than normal healthy individuals (Fig. 2).
Anzeige
Fig. 2
The RBCs of CDA II patients show an increased level of CD44 (MCF: 490) as compared to the RBCs of a normal healthy individual (MCF: 220)
×
![]()
Sanger sequencing for SEC23B-Y462C mutation
The Sanger sequencing was performed for confirmed diagnosis ofCDAII in patients and also to verify the results obtained by HRM analysis. Sanger sequencing revealed substitution of nucleotide in exon 12 in SEC23B gene at codon 462 (TAT →TGT), which corresponds to homozygous Tyr462Cys (Y462C) mutation in all patients (Fig. 3B), and their parents and some of the family members showed heterozygous p.Y462C genotype for CDAII having normal phenotype (Fig. 3C) (Table 2). There was no other mutation present in the SEC23B gene in any of the patients.
Fig. 3
Sanger sequencing of an amplified DNA fragment of exon 12 of SEC23B gene (A) Normal (Wild Type) (B) TGT/TGT (Homozygous) (C) TAT/TGT (Heterozygous for CDA having normal phenotype) and HRM profile for genotypic differentiation. (D) Melt curve showing homozygous (Y462C), heterozygous, and normal wild type. (E) Difference plot showing homozygous (Y462C), heterozygous and normal wild type
×
![]()
Table 2
Genotyping of SEC23B – Y462C mutation in patients with CDA and family members using HRM analysis and Sanger sequencing
Family | Number | Relationship | Clinical Diagnosis | Nucleotide change | Amino acid change | |
|---|---|---|---|---|---|---|
Sanger Sequencing | HRM analysis | |||||
F1 | I – 1 | Mother | Normal | TAT/TGT | TAT/TGT | N/Y462C |
I – 2 | Father | Normal | TAT/TGT | TAT/TGT | N/Y462C | |
II – 1 | Daughter | Normal | TAT/TAT | TAT/TAT | N/N | |
II − 2 | Son |
CDA
| TGT/TGT | TGT/TGT | Y462C/Y462C | |
F2 | I – 1 | Mother | Normal | TAT/TGT | TAT/TGT | N/Y462C |
I – 2 | Father | Normal | TAT/TGT | TAT/TGT | N/Y462C | |
II – 1 | Son |
CDA
| TGT/TGT | TGT/TGT | Y462C/Y462C | |
II – 2 | Daughter | Normal | Not Done | Not Done | Not Done | |
II − 3 | Daughter | Normal | Not Done | Not Done | Not Done | |
F3 | I – 1 | Mother | Normal | TAT/TGT | TAT/TGT | N/Y462C |
I – 2 | Father | Normal | TAT/TGT | TAT/TGT | N/Y462C | |
II − 1 | Son |
CDA
| TGT/TGT | TGT/TGT | Y462C/Y462C | |
F4 | I – 1 | Mother | Normal | TAT/TGT | TAT/TGT | N/Y462C |
I – 2 | Father | Normal | TAT/TGT | TAT/TGT | N/Y462C | |
II- 1 | Daughter | Normal | TAT/TGT | TAT/TGT | N/Y462C | |
II – 2 | Daughter |
CDA
| TGT/TGT | TGT/TGT | Y462C/Y462C | |
II − 3 | Son | Normal | TAT/TGT | TAT/TGT | N/Y462C | |
F5 | I – 1 | Mother | Normal | TAT/TGT | TAT/TGT | N/Y462C |
I – 2 | Father | Normal | TAT/TGT | TAT/TGT | N/Y462C | |
II – 1 | Son | Normal | TAT/TAT | TAT/TAT | N/N | |
II – 2 | Daughter | Normal | Not Done | Not Done | Not Done | |
II − 3 | Son |
CDA
| TGT/TGT | TGT/TGT | Y462C/Y462C | |
F6 | I – 1 | Mother | Normal | TAT/ TGT | TAT/ TGT | N/Y462C |
I – 2 | Father | Normal | TAT/ TGT | TAT/ TGT | N/Y462C | |
II − 1 | Son |
CDA
| TGT/ TGT | TGT/ TGT | Y462C/Y462C | |
F7 | I – 1 | Mother | Normal | TAT/ TGT | TAT/ TGT | N/Y462C |
I – 2 | Father | Normal | TAT/ TGT | TAT/ TGT | N/Y462C | |
II – 1 | Daughter | Normal | TAT/ TGT | TAT/ TGT | N/Y462C | |
II – 2 | Daughter |
CDA
| TGT/ TGT | TGT/ TGT | Y462C/Y462C | |
II − 3 | Son |
CDA
| TGT/ TGT | TGT/ TGT | Y462C/Y462C | |
F8 | I – 1 | Mother | Normal | TAT/ TGT | TAT/ TGT | N/Y462C |
I – 2 | Father | Normal | TAT/ TGT | TAT/ TGT | N/Y462C | |
II – 1 | Son |
CDA
| TGT/ TGT | TGT/ TGT | Y462C/Y462C | |
II − 2 | Son | Normal | TAT/ TGT | TAT/ TGT | N/Y462C | |
F9 | I – 1 | Mother | Normal | TAT/ TGT | TAT/ TGT | N/Y462C |
I – 2 | Father | Normal | TAT/ TGT | TAT/ TGT | N/Y462C | |
II – 1 | Daughter | Normal | TAT/ TGT | TAT/ TGT | N/Y462C | |
II – 2 | Son |
CDA
| TGT/ TGT | TGT/ TGT | Y462C/Y462C | |
II − 3 | Daughter | Normal | TAT/ TGT | TAT/ TGT | N/Y462C | |
F10 | I – 1 | Mother | Normal | TAT/ TGT | TAT/ TGT | N/Y462C |
I – 2 | Father | Normal | TAT/ TGT | TAT/ TGT | N/Y462C | |
II – 1 | Daughter | Not Done | Not Done | Not Done | Not Done | |
II − 2 | Daughter |
CDA
| TGT/ TGT | TGT/ TGT | Y462C/Y462C | |
Anzeige
HRM screening of SEC23B-Y462C mutation
Results of HRM analysis showed the presence of a prominent peak of homozygous c.1385 A > G, (p.Y462C) mutation in all index cases. Analysis was performed by HRM analysis software v3.0.1. HRM profile for genotypic differentiation in the melting curve showing homozygous (Y462C), heterozygous, and wild type is shown in (Fig. 3D), and a difference plot showing homozygous (Y462C), heterozygous and wild type is shown in (Fig. 3E). The high-resolution melting curves and difference plots of patients showed the homozygous mutation, and their parents showed the heterozygous mutation. On the RT-PCR screen of HRM analysis, all patients showed a prominent peak of homozygous Y462C mutations, and their parents showed the heterozygous peak of Y462Cmutation.
Discussion
Congenital Dyserythropoietic Anemia (CDA) is a very rare disease. The diagnosis of CDA is difficult because of the lack of detailed diagnostic procedures. It is mainly diagnosed when other causes of hemolytic anemia are ruled out and this often delays the diagnosis [2]. Thus, many patients suffering from CDA have no precise diagnosis, because of which effective patient management and genetic counseling are often delayed or missed as it happens in most of the rare disorders [15]. Currently, morphological analysis of bone marrow aspirate, molecular characterization using next-generation sequencing, and Sanger sequencing are considered to be confirmatory diagnostic tests. These tests are costly and time-consuming. In the Indian population, many patients suffering from CDAII show c.1385 A > G, p.Tyr462Cys mutation in the SEC23B gene. Thus, in this study, we have developed an HRM analysis method to detect c.1385 A > G, p.Y462C mutation in the SEC23B gene causing CDA II. High-resolution melting (HRM) curve analysis is a polymerase chain reaction-based technique that identifies genetic differences and scans nucleic acid sequences. The SEC23B variations are currently detected using conventional methods like PCR-SSCP, allele-specific amplification, Sanger sequencing and next-generation sequencing [8]. All of these methods are lengthy and costly. They involve open tube assays, which need processing after PCR. The post-PCR processing includes electrophoresis and/or sequencing. This method makes it very laborious. Further, PCR products need to be transferred for further analysis. In this, there is a high risk of contamination. For Sanger sequencing and NGS, specific instruments are required which are not available in all the laboratories. Wittwer and his colleagues developed a high-resolution melting curve analysis of amplified products using dsDNA dye in the late 1990s [16, 17]. The advantage of the HRM method is that the same reaction tube is used for amplification and detection steps. This eliminates possible post-PCR contaminations that can occur in above mentioned conventional methods. For laboratories with a large number of samples for analysis or laboratories with less funding, it is challenging to do DNA Sanger sequencing even though now the cost for the same is relatively low. After isolating and extracting genomic DNA, the HRM analysis takes only a few hours to completion, and visually comparing the melting curves on the RT-PCR screen is sufficient for diagnosis. This makes the process fast and has high throughput. Analysis using a High-Resolution Melting curve is economically beneficial as the technique has minimal requirements[18]. The cost of saturating DNA dye is less than PCR reagents, although the thermal cycler capable of measuring real-time fluorescence is required. Using the HRM method, identifying single-base changes that cause heterozygosity is possible [19]. In this study, HRM analysis showed homozygous Y462C mutation in all CDA II patients, and their parents and a few family members showed heterozygous Y462C mutation. We used Sanger sequencing for confirmation of the diagnosis of CDA II and verification of the results obtained by HRM analysis. This confirmed the efficiency of HRM analysis in screening common SEC23B mutation in CDA II patients in the Indian population. In all the cases, diagnosis and confirmation were carried out using biochemical tests – low MCF in EMA and raised CD44 antibody binding and molecular tests – HRM and Sanger sequencing. Thus, patients suspected to have CDA II based on clinical features like moderate to severe anemia, normal to slightly high reticulocyte count, increased ferritin and LDH levels could be diagnosed on the basis of EMA followed by CD44 antibody binding and screening for common mutation in the Indian population using HRM analysis. All these tests are cost-effective and require less time compared to currently used other methods like next-generation sequencing and Sanger sequencing.
Conclusion
Considering these advantages of HRM, we have developed a protocol for studying the common mutation (SEC23B-Y462C) causing congenital dyserythropoietic anemia type II in the Indian population. Our data showed that High-Resolution Melting (HRM) analysis could be used for rapid screening of common SEC23B mutation that causes CDAII in the Indian population. HRM technique leads to an accurate diagnosis in CDAII patients and does not need further diagnostic workup. Earlier incorporation of HRM technique for diagnosing CDAII in Indian patients will improve patient care and enable genetic counselling and prenatal diagnosis.
Acknowledgements
We would like to thank patients and family members for their cooperation and participation in this study. This study was performed with the financial support of the Indian Council of Medical Research, New Delhi and Lady Tata Memorial Trust.
Declarations
Ethical approval and consent participation
This study was approved by the Ethics Committee of the Institutional Ethical Committee of ICMR-National Institute of Immunohaematology, Mumbai. All procedures performed in studies involving human participants were as per the ethical standards of the institutional review board of the Institute and with the 1964 Helsinki Declaration and its later amendments or comparable ethical standards. Written informed consent was obtained from all participants or if participants are under 16, from a parent and/or legal guardian.
Anzeige
Consent for publication
We obtained written informed consent to identify images or other personal or clinical details of all the participants. In the case of a minor, we obtained written informed consent for the publication of identifying pictures or additional clinical information from the parents or legal guardians.
Conflict of interest
The authors have no competing interests.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.